View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18532_high_48 (Length: 204)
Name: NF18532_high_48
Description: NF18532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18532_high_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 17 - 187
Target Start/End: Complemental strand, 6613578 - 6613408
Alignment:
| Q |
17 |
ctgatattttgcatttcacgatgacattcaacaatattatttttcaacttacgacaatggtccttgctccaagaagacatgtcttctgcgctggctgaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
6613578 |
ctgatattttgcatttcacgatgacattcaacaatattatttttcaacttacgacaatggtccttactccaagaagacatatcttctgcgctggctgaaa |
6613479 |
T |
|
| Q |
117 |
gttttggaattatgctagtgtgattagtcatgttccacgcattagtgacgacttctctaaagctaggttca |
187 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
6613478 |
gttttggaattatgctagtgtgatcagtcatgttccacacattagtgacgacttctctaaagccaggttca |
6613408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University