View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18532_low_38 (Length: 289)
Name: NF18532_low_38
Description: NF18532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18532_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 18 - 157
Target Start/End: Complemental strand, 883662 - 883523
Alignment:
| Q |
18 |
attatttgtatcgattgtctaatgttcgtgtatgtgttcctgcttcatatcacttgttgatttgaatgagttatcagatgtttgggtttgaggaagttga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
883662 |
attatttgtatcgattgtctaatgttcgtgtatgtgttcatgcttcatatcacttgttgatttgaacgagttatcagatgtttgggtttgaggaagttga |
883563 |
T |
 |
| Q |
118 |
gacccctgactttggagagttaaaggttatatggttgcgc |
157 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
883562 |
gacccctgactttggagagttaaagattatatggttgcgc |
883523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 181 - 286
Target Start/End: Complemental strand, 883505 - 883400
Alignment:
| Q |
181 |
acttatccatctcatacaacgtagcaacggcgagctggctccatcatcctccattcctgttaaagacccctctcatatccgcttaggccatcatctctgc |
280 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
883505 |
acttatccatctcatacaacatagcaacggcgagctggctccatcatcctccattcctgttaaagacccctctcatatccgcttaggccatcatctttgc |
883406 |
T |
 |
| Q |
281 |
tcctcc |
286 |
Q |
| |
|
| |||| |
|
|
| T |
883405 |
ttctcc |
883400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University