View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18532_low_53 (Length: 230)

Name: NF18532_low_53
Description: NF18532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18532_low_53
NF18532_low_53
[»] chr8 (1 HSPs)
chr8 (22-207)||(18407263-18407448)


Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 22 - 207
Target Start/End: Original strand, 18407263 - 18407448
Alignment:
22 acgaatgacattgatcggacattagttggttctgccattaattctggaagacggccaccttccatgagaccgaaatctgattttgattttcggtttcttt 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
18407263 acgaatgacattgatcggacattagttggttctgccattaattctggaagacggccacctaccatgagaccgaaatctgattttgattttcggtttcttt 18407362  T
122 tgtatgggaggattcttgggaagaagaaatttgatggttgcatgcagccctgtactgcatgttcgtcgtccaggattgcaatggat 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18407363 tgtatgggaggattcttgggaagaagaaatttgatggttgcatgcagccctgtactgcatgttcgtcgtccaggattgcaatggat 18407448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University