View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18532_low_53 (Length: 230)
Name: NF18532_low_53
Description: NF18532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18532_low_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 22 - 207
Target Start/End: Original strand, 18407263 - 18407448
Alignment:
| Q |
22 |
acgaatgacattgatcggacattagttggttctgccattaattctggaagacggccaccttccatgagaccgaaatctgattttgattttcggtttcttt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18407263 |
acgaatgacattgatcggacattagttggttctgccattaattctggaagacggccacctaccatgagaccgaaatctgattttgattttcggtttcttt |
18407362 |
T |
 |
| Q |
122 |
tgtatgggaggattcttgggaagaagaaatttgatggttgcatgcagccctgtactgcatgttcgtcgtccaggattgcaatggat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18407363 |
tgtatgggaggattcttgggaagaagaaatttgatggttgcatgcagccctgtactgcatgttcgtcgtccaggattgcaatggat |
18407448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University