View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18532_low_54 (Length: 230)
Name: NF18532_low_54
Description: NF18532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18532_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 26 - 220
Target Start/End: Complemental strand, 53067601 - 53067406
Alignment:
| Q |
26 |
tggataagccatggaaaccaaccgcaagcaattgaaaccagccgaattccaaaccaaaaaacagttcttaatattcttgatcaaaacaacatggtcggcc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53067601 |
tggataagccatggaaaccaaccgcaagcaattgaaaccagccgaattccaaaccaaaaaacagttcttaatattcttgatcaaaacaacatggtcggcc |
53067502 |
T |
|
| Q |
126 |
ttgtcataa-aaaactctcaccacaccctcaacaagcgttggtacagtgccgttccgtcgacatgtagttccgatgccgaccttccatccgctgtg |
220 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53067501 |
gtgtcataaaaaaactctcaccacaccctcaacaagcgttggtacagtgccgttccgtcgacatgtagttccgatgccgaccttccatcctctgtg |
53067406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University