View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18533_low_6 (Length: 291)
Name: NF18533_low_6
Description: NF18533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18533_low_6 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 11 - 291
Target Start/End: Complemental strand, 30190103 - 30189823
Alignment:
| Q |
11 |
cacagagcaccatatatgccatacgccaactagaagaaataaggttccaggcaaaatatgacctatgaaagatcccatttttctgatttacttttaccac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30190103 |
cacagagcaccatatatgccatacgccaactagaagaaataaggttccaggcaaaatatgacctatgaaagatcccatttttctgatttacttttaccac |
30190004 |
T |
 |
| Q |
111 |
tctcaaaataaataattcaagttcacttagtacttgtttggttccgcatccagcttgtaaatcttgtgtctccgtgtcgtttacactgcagttttatgaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30190003 |
tctcaaaataaataattcaagttcacttagtacttgtttggttccgcatccagcttgtaaatcttgtgtctccgtgtcgtttacactgcagttttatgaa |
30189904 |
T |
 |
| Q |
211 |
ggtagaaattcaagctacagtctcactaaaatgcacttaatcaattggatccttgaatgattcttcagctgattatagcaa |
291 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30189903 |
ggtagaaactcaagctacagtctcactaaaatgcacttaatcaactggatccttgaatgattcttcagctgatcatagcaa |
30189823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University