View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18533_low_8 (Length: 282)
Name: NF18533_low_8
Description: NF18533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18533_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 4 - 264
Target Start/End: Complemental strand, 30189819 - 30189560
Alignment:
| Q |
4 |
aaatgtttccatcttgtaaacataccaaagaatcctgnnnnnnnnaataaaagcaa-tcagttttcaaactttcagtgacaaacttttcggatgaaagtt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
30189819 |
aaatgtttccatcttgtaaacataccaaagaatcctgttttttt-aataaaagcaaatcagttttgaaactttcagtgacaa-cttttcggatgaaagtt |
30189722 |
T |
|
| Q |
103 |
caatatcatcttataacacattggaatcagcatacaaacaacgtatgtatgcttttacagattccatatcaaaattttgaactactttgccagctatttc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30189721 |
caatatcatcttataacacattggaatcagcatacaaacaacgtatgtatgcttttacagattccatatcaaaattttgaactactttgccagctatttc |
30189622 |
T |
|
| Q |
203 |
tactttgaaagaaaaactgaattcatctttttgctataatttatatctaacaatgatataga |
264 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30189621 |
tgctttgaaagaaaaactgaattcatctttttgctataatttatatctagcaatgatataga |
30189560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University