View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18536_high_11 (Length: 282)
Name: NF18536_high_11
Description: NF18536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18536_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 13 - 194
Target Start/End: Complemental strand, 4093671 - 4093490
Alignment:
| Q |
13 |
aatatgaaatggaacaaattattggaatgccctaacaataagaaaatgtaagttaattcttttatgttggcgtcggcagagaattagagatgcaccaaac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4093671 |
aatatgaaatggaacaaattattggaatgccataacaataagaaaatgttaattaattattttatgttggcgtcggtagagaattagagatgcaccaaac |
4093572 |
T |
 |
| Q |
113 |
catgtgccaatatctctttgatttggagggagtaatgttggaaaaaactacctccaatgtaaataatatttgattttgagat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4093571 |
catgtgccaatatctctttgatttggagggagtaatgttggaaaaaactacctccaatgtaaataatatttgattttgagat |
4093490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 192 - 263
Target Start/End: Complemental strand, 4093441 - 4093370
Alignment:
| Q |
192 |
gatggaacttttgtgacctcggcaaacagtcggccatgctttaagtcagatgcgttgtgtttaagtcgtatg |
263 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4093441 |
gatggaacttttgtgacctcggcaaatagtcggccatgctttaagtcagatgcgttgtgtttaagttgtatg |
4093370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University