View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18536_high_12 (Length: 276)

Name: NF18536_high_12
Description: NF18536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18536_high_12
NF18536_high_12
[»] chr7 (3 HSPs)
chr7 (177-270)||(44492580-44492673)
chr7 (46-109)||(44492741-44492811)
chr7 (17-48)||(44493222-44493253)


Alignment Details
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 177 - 270
Target Start/End: Complemental strand, 44492673 - 44492580
Alignment:
177 ggatccccctgaactactcagtgtacgtgtctaattcaactatacaaaatcggtttataaaaactatgtacttataaacaaatgttcatctcac 270  Q
    |||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||    
44492673 ggatccccctgaactactcaatgtacgtgtttaattcaactatacaaaatcgatttataaaaactatctacttataaacaaatgttcatatcac 44492580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 46 - 109
Target Start/End: Complemental strand, 44492811 - 44492741
Alignment:
46 taacaaagcaacttagaggttggggaaccc-------aagtaaccaaatttagattcaatttttcatgtta 109  Q
    ||||||||||||||||||||||||||||||       ||||||||||||||||||| ||||||||||||||    
44492811 taacaaagcaacttagaggttggggaacccaagtcccaagtaaccaaatttagatttaatttttcatgtta 44492741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 48
Target Start/End: Complemental strand, 44493253 - 44493222
Alignment:
17 actaatctagtagtagcagccctttcctataa 48  Q
    ||||||||||||||||||||||||||||||||    
44493253 actaatctagtagtagcagccctttcctataa 44493222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University