View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18536_low_15 (Length: 276)
Name: NF18536_low_15
Description: NF18536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18536_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 177 - 270
Target Start/End: Complemental strand, 44492673 - 44492580
Alignment:
| Q |
177 |
ggatccccctgaactactcagtgtacgtgtctaattcaactatacaaaatcggtttataaaaactatgtacttataaacaaatgttcatctcac |
270 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
44492673 |
ggatccccctgaactactcaatgtacgtgtttaattcaactatacaaaatcgatttataaaaactatctacttataaacaaatgttcatatcac |
44492580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 46 - 109
Target Start/End: Complemental strand, 44492811 - 44492741
Alignment:
| Q |
46 |
taacaaagcaacttagaggttggggaaccc-------aagtaaccaaatttagattcaatttttcatgtta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
44492811 |
taacaaagcaacttagaggttggggaacccaagtcccaagtaaccaaatttagatttaatttttcatgtta |
44492741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 48
Target Start/End: Complemental strand, 44493253 - 44493222
Alignment:
| Q |
17 |
actaatctagtagtagcagccctttcctataa |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44493253 |
actaatctagtagtagcagccctttcctataa |
44493222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University