View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18537_high_12 (Length: 420)

Name: NF18537_high_12
Description: NF18537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18537_high_12
NF18537_high_12
[»] chr4 (79 HSPs)
chr4 (171-414)||(45961754-45961998)
chr4 (16-80)||(20639659-20639723)
chr4 (17-80)||(44363131-44363194)
chr4 (19-80)||(38755909-38755970)
chr4 (18-80)||(11394924-11394986)
chr4 (18-80)||(11404651-11404713)
chr4 (18-80)||(35567242-35567304)
chr4 (19-80)||(23501862-23501923)
chr4 (19-80)||(33836488-33836549)
chr4 (16-68)||(20908649-20908701)
chr4 (16-76)||(21489158-21489218)
chr4 (20-80)||(32484307-32484367)
chr4 (20-80)||(40553938-40553998)
chr4 (18-80)||(7909281-7909344)
chr4 (17-80)||(30352581-30352644)
chr4 (18-80)||(5648330-5648392)
chr4 (18-80)||(6430627-6430689)
chr4 (18-80)||(20225054-20225116)
chr4 (19-85)||(20225149-20225215)
chr4 (18-80)||(25629121-25629183)
chr4 (18-80)||(38786681-38786743)
chr4 (19-80)||(25388249-25388310)
chr4 (18-79)||(29207900-29207961)
chr4 (21-80)||(30690177-30690236)
chr4 (18-80)||(14983906-14983968)
chr4 (18-80)||(30639451-30639513)
chr4 (18-80)||(40915900-40915962)
chr4 (18-80)||(8473621-8473685)
chr4 (23-80)||(13256400-13256457)
chr4 (19-80)||(16408602-16408663)
chr4 (19-80)||(16911637-16911698)
chr4 (31-80)||(35532077-35532126)
chr4 (79-140)||(45962173-45962233)
chr4 (16-80)||(54175134-54175199)
chr4 (20-80)||(44718641-44718701)
chr4 (19-78)||(21647039-21647098)
chr4 (18-85)||(32478788-32478854)
chr4 (17-80)||(47482851-47482914)
chr4 (18-80)||(9832314-9832376)
chr4 (18-80)||(11054149-11054211)
chr4 (16-78)||(36589814-36589876)
chr4 (18-80)||(47444029-47444091)
chr4 (18-80)||(47528531-47528593)
chr4 (18-80)||(48598826-48598888)
chr4 (18-60)||(49796869-49796911)
chr4 (18-80)||(51865039-51865101)
chr4 (18-80)||(5306661-5306727)
chr4 (19-80)||(20405162-20405223)
chr4 (19-80)||(50555657-50555718)
chr4 (16-80)||(36816385-36816449)
chr4 (19-70)||(54730325-54730376)
chr4 (19-80)||(2813200-2813262)
chr4 (19-80)||(55766467-55766528)
chr4 (18-78)||(54967092-54967151)
chr4 (21-80)||(19027986-19028045)
chr4 (18-61)||(25463194-25463237)
chr4 (18-77)||(28494223-28494282)
chr4 (16-63)||(49938611-49938658)
chr4 (30-80)||(56322984-56323034)
chr4 (16-65)||(30581481-30581530)
chr4 (32-69)||(37038135-37038172)
chr4 (18-67)||(37494923-37494972)
chr4 (19-80)||(48327764-48327825)
chr4 (19-80)||(55830722-55830783)
chr4 (20-72)||(487135-487187)
chr4 (16-80)||(7038123-7038186)
chr4 (19-67)||(8820581-8820629)
chr4 (24-80)||(12666858-12666914)
chr4 (18-77)||(9987838-9987897)
chr4 (17-72)||(16494290-16494345)
chr4 (44-79)||(17315336-17315371)
chr4 (18-77)||(39077800-39077859)
chr4 (21-71)||(19027923-19027973)
chr4 (17-63)||(39029078-39029124)
chr4 (18-58)||(7385499-7385539)
chr4 (18-62)||(17043413-17043457)
chr4 (44-80)||(19425923-19425959)
chr4 (20-80)||(21003410-21003469)
chr4 (31-67)||(48202395-48202431)
[»] scaffold0003 (1 HSPs)
scaffold0003 (169-420)||(291834-292089)
[»] chr2 (62 HSPs)
chr2 (17-80)||(10543771-10543834)
chr2 (18-80)||(9671251-9671313)
chr2 (18-80)||(10546235-10546297)
chr2 (19-80)||(14530393-14530454)
chr2 (18-80)||(8455317-8455379)
chr2 (18-80)||(14444800-14444862)
chr2 (18-80)||(25249739-25249801)
chr2 (20-80)||(40579750-40579810)
chr2 (17-76)||(23488554-23488613)
chr2 (18-80)||(21779262-21779324)
chr2 (18-80)||(36871564-36871625)
chr2 (19-80)||(25079718-25079779)
chr2 (21-80)||(34080176-34080235)
chr2 (21-80)||(34766330-34766389)
chr2 (20-79)||(41409936-41409995)
chr2 (18-80)||(17668074-17668136)
chr2 (18-80)||(25632581-25632643)
chr2 (18-80)||(26684621-26684683)
chr2 (18-80)||(40762235-40762297)
chr2 (18-80)||(44643595-44643657)
chr2 (19-80)||(5841103-5841164)
chr2 (19-80)||(39914307-39914367)
chr2 (17-80)||(14544137-14544200)
chr2 (33-80)||(22371199-22371246)
chr2 (17-80)||(24200624-24200687)
chr2 (26-80)||(8575975-8576029)
chr2 (18-80)||(11514508-11514569)
chr2 (18-80)||(17623636-17623698)
chr2 (18-80)||(17896332-17896394)
chr2 (18-80)||(21377075-21377136)
chr2 (18-80)||(23397836-23397898)
chr2 (33-77)||(124918-124962)
chr2 (17-69)||(31158451-31158503)
chr2 (26-69)||(19615073-19615116)
chr2 (18-69)||(19977726-19977777)
chr2 (18-77)||(24859992-24860051)
chr2 (21-68)||(24890486-24890533)
chr2 (18-80)||(13245096-13245158)
chr2 (18-80)||(25641573-25641635)
chr2 (27-80)||(3633709-3633762)
chr2 (21-78)||(4516354-4516411)
chr2 (17-64)||(19185760-19185807)
chr2 (18-73)||(31523303-31523358)
chr2 (18-69)||(39499242-39499293)
chr2 (19-80)||(1289095-1289157)
chr2 (18-80)||(27573692-27573754)
chr2 (20-65)||(24059012-24059057)
chr2 (40-80)||(40416872-40416912)
chr2 (16-71)||(17471620-17471675)
chr2 (18-69)||(31821355-31821406)
chr2 (18-61)||(32781308-32781351)
chr2 (30-77)||(39189508-39189555)
chr2 (18-68)||(4794874-4794924)
chr2 (16-78)||(45235820-45235882)
chr2 (18-71)||(12023929-12023982)
chr2 (20-61)||(33795359-33795400)
chr2 (16-69)||(44449395-44449448)
chr2 (16-80)||(4795825-4795889)
chr2 (17-77)||(7214607-7214667)
chr2 (27-67)||(22363509-22363549)
chr2 (40-80)||(23052966-23053006)
chr2 (18-78)||(31525778-31525838)
[»] scaffold0057 (4 HSPs)
scaffold0057 (18-80)||(46903-46965)
scaffold0057 (18-80)||(24773-24835)
scaffold0057 (16-67)||(46721-46772)
scaffold0057 (18-80)||(43729-43792)
[»] chr5 (60 HSPs)
chr5 (18-80)||(16957386-16957448)
chr5 (19-80)||(38879656-38879717)
chr5 (18-80)||(24448962-24449024)
chr5 (19-80)||(25622533-25622594)
chr5 (17-80)||(43334276-43334338)
chr5 (18-80)||(32703494-32703556)
chr5 (18-69)||(7097772-7097823)
chr5 (18-80)||(8169985-8170047)
chr5 (22-80)||(16028625-16028683)
chr5 (19-77)||(27328827-27328885)
chr5 (18-80)||(34154815-34154877)
chr5 (18-80)||(41014390-41014452)
chr5 (18-72)||(43574678-43574732)
chr5 (19-80)||(4619105-4619166)
chr5 (19-80)||(12006329-12006390)
chr5 (19-80)||(13801768-13801829)
chr5 (17-78)||(21784335-21784396)
chr5 (16-80)||(12575661-12575725)
chr5 (21-77)||(39801591-39801647)
chr5 (16-62)||(10306493-10306539)
chr5 (18-80)||(16880648-16880710)
chr5 (18-80)||(22861670-22861732)
chr5 (22-80)||(30877565-30877623)
chr5 (30-80)||(32354211-32354261)
chr5 (18-80)||(35710383-35710445)
chr5 (16-69)||(4654427-4654480)
chr5 (21-78)||(7368471-7368528)
chr5 (19-80)||(20135679-20135740)
chr5 (16-80)||(11657700-11657764)
chr5 (16-80)||(37225962-37226026)
chr5 (21-80)||(3771414-3771473)
chr5 (13-80)||(28516434-28516501)
chr5 (18-77)||(30006397-30006456)
chr5 (18-80)||(1405259-1405321)
chr5 (18-80)||(1565504-1565565)
chr5 (18-68)||(19142956-19143006)
chr5 (19-80)||(29334469-29334530)
chr5 (16-72)||(208936-208992)
chr5 (44-80)||(29184062-29184098)
chr5 (21-80)||(5873323-5873382)
chr5 (25-80)||(10943846-10943900)
chr5 (17-80)||(19093884-19093947)
chr5 (30-72)||(13774949-13774991)
chr5 (9-59)||(21542489-21542539)
chr5 (18-71)||(1850711-1850764)
chr5 (34-79)||(11462913-11462958)
chr5 (16-69)||(12477132-12477185)
chr5 (16-77)||(39079755-39079816)
chr5 (40-80)||(18099955-18099995)
chr5 (40-76)||(18684367-18684403)
chr5 (16-72)||(39301194-39301249)
chr5 (18-61)||(22600526-22600569)
chr5 (18-64)||(15141952-15141998)
chr5 (27-80)||(22187368-22187421)
chr5 (16-80)||(24313573-24313638)
chr5 (16-80)||(24355910-24355975)
chr5 (18-58)||(2838850-2838890)
chr5 (19-67)||(18426112-18426160)
chr5 (40-80)||(19438760-19438800)
chr5 (40-80)||(42924831-42924871)
[»] chr3 (64 HSPs)
chr3 (18-80)||(40272813-40272875)
chr3 (18-80)||(54484785-54484847)
chr3 (19-80)||(13628791-13628852)
chr3 (16-80)||(25517171-25517235)
chr3 (17-80)||(516505-516568)
chr3 (16-71)||(829452-829507)
chr3 (17-80)||(5173720-5173783)
chr3 (17-80)||(45786215-45786278)
chr3 (18-80)||(22609859-22609921)
chr3 (18-80)||(24851302-24851364)
chr3 (18-80)||(39203608-39203670)
chr3 (18-80)||(52926220-52926282)
chr3 (19-80)||(13730603-13730664)
chr3 (19-80)||(29366721-29366782)
chr3 (19-79)||(353351-353411)
chr3 (17-80)||(10795424-10795487)
chr3 (21-80)||(30452892-30452951)
chr3 (18-80)||(1217182-1217244)
chr3 (26-80)||(10484617-10484671)
chr3 (18-80)||(15797314-15797376)
chr3 (18-80)||(22122918-22122980)
chr3 (18-80)||(26869800-26869862)
chr3 (18-80)||(31592941-31593003)
chr3 (18-80)||(34771365-34771427)
chr3 (19-80)||(46421035-46421097)
chr3 (19-80)||(49013474-49013535)
chr3 (36-80)||(40390353-40390397)
chr3 (16-80)||(53996566-53996630)
chr3 (21-80)||(14266373-14266431)
chr3 (33-80)||(47624208-47624255)
chr3 (18-80)||(16735534-16735596)
chr3 (21-71)||(45948848-45948898)
chr3 (19-79)||(8247688-8247749)
chr3 (19-80)||(14987054-14987115)
chr3 (16-77)||(44403559-44403620)
chr3 (16-69)||(54374357-54374410)
chr3 (40-80)||(4495677-4495717)
chr3 (16-80)||(25944562-25944626)
chr3 (16-68)||(34420656-34420708)
chr3 (40-80)||(54032572-54032612)
chr3 (18-80)||(12914036-12914098)
chr3 (18-80)||(26292424-26292486)
chr3 (21-79)||(26573224-26573282)
chr3 (18-70)||(6411833-6411885)
chr3 (18-77)||(7943084-7943143)
chr3 (42-80)||(23871484-23871522)
chr3 (16-77)||(55401269-55401330)
chr3 (18-78)||(35417998-35418058)
chr3 (40-80)||(43956473-43956513)
chr3 (17-80)||(45139479-45139540)
chr3 (25-80)||(45288056-45288111)
chr3 (21-80)||(50624954-50625013)
chr3 (18-80)||(24577929-24577991)
chr3 (18-80)||(24578019-24578081)
chr3 (40-86)||(31831302-31831348)
chr3 (19-65)||(33926178-33926224)
chr3 (35-80)||(6242286-6242331)
chr3 (18-67)||(43114882-43114931)
chr3 (18-67)||(46169981-46170030)
chr3 (27-80)||(51644074-51644127)
chr3 (16-68)||(10696226-10696278)
chr3 (21-77)||(19731099-19731155)
chr3 (28-80)||(45416935-45416986)
chr3 (28-72)||(52428479-52428523)
[»] chr1 (69 HSPs)
chr1 (18-80)||(4349733-4349795)
chr1 (17-80)||(35005219-35005282)
chr1 (17-80)||(50606497-50606560)
chr1 (18-80)||(46247954-46248016)
chr1 (19-80)||(10668323-10668384)
chr1 (19-80)||(27474376-27474437)
chr1 (18-78)||(45402191-45402251)
chr1 (17-80)||(42304208-42304271)
chr1 (19-78)||(46991900-46991959)
chr1 (19-80)||(18944741-18944803)
chr1 (18-80)||(19414532-19414594)
chr1 (18-80)||(34725099-34725161)
chr1 (17-80)||(18741958-18742021)
chr1 (17-80)||(27201743-27201806)
chr1 (18-77)||(45812541-45812600)
chr1 (18-76)||(4587568-4587626)
chr1 (19-77)||(6925196-6925254)
chr1 (18-80)||(14617133-14617195)
chr1 (18-80)||(35253188-35253250)
chr1 (16-69)||(19701664-19701717)
chr1 (19-80)||(20004091-20004152)
chr1 (19-80)||(30395727-30395788)
chr1 (17-80)||(9939557-9939621)
chr1 (18-70)||(15505659-15505710)
chr1 (21-80)||(1517312-1517371)
chr1 (18-72)||(30555210-30555264)
chr1 (18-80)||(31382215-31382277)
chr1 (18-80)||(32632558-32632620)
chr1 (18-80)||(38478283-38478345)
chr1 (16-78)||(39214961-39215023)
chr1 (27-80)||(25554743-25554796)
chr1 (18-78)||(10378738-10378798)
chr1 (16-71)||(2435796-2435851)
chr1 (16-79)||(15511150-15511213)
chr1 (21-68)||(33594144-33594191)
chr1 (21-80)||(43768237-43768296)
chr1 (18-80)||(6983812-6983874)
chr1 (18-80)||(8197138-8197200)
chr1 (18-80)||(12126838-12126900)
chr1 (17-79)||(19932755-19932817)
chr1 (18-80)||(20999851-20999913)
chr1 (18-76)||(23768325-23768383)
chr1 (18-80)||(23796560-23796622)
chr1 (16-74)||(31442396-31442454)
chr1 (18-80)||(41319807-41319869)
chr1 (34-80)||(50760241-50760287)
chr1 (16-69)||(45264411-45264464)
chr1 (17-72)||(35117774-35117830)
chr1 (16-80)||(50812034-50812097)
chr1 (18-69)||(4249455-4249506)
chr1 (18-69)||(4249779-4249830)
chr1 (18-69)||(4250103-4250154)
chr1 (18-61)||(11596607-11596650)
chr1 (18-61)||(30682907-30682950)
chr1 (18-69)||(47214604-47214655)
chr1 (17-79)||(22324988-22325049)
chr1 (16-65)||(6358215-6358264)
chr1 (16-80)||(19974075-19974139)
chr1 (21-77)||(35019328-35019383)
chr1 (26-80)||(16120819-16120873)
chr1 (18-72)||(20036316-20036369)
chr1 (18-72)||(23371218-23371271)
chr1 (18-72)||(44485119-44485172)
chr1 (42-79)||(34679217-34679254)
chr1 (18-58)||(21910673-21910712)
chr1 (33-77)||(22327206-22327250)
chr1 (40-80)||(24564451-24564491)
chr1 (40-80)||(31272382-31272422)
chr1 (16-80)||(41440603-41440667)
[»] chr6 (37 HSPs)
chr6 (19-80)||(29355856-29355917)
chr6 (19-80)||(6808468-6808529)
chr6 (17-80)||(12885984-12886047)
chr6 (18-80)||(1347034-1347096)
chr6 (18-80)||(1354758-1354820)
chr6 (19-80)||(12221915-12221977)
chr6 (18-80)||(13267797-13267859)
chr6 (19-80)||(12892082-12892143)
chr6 (19-77)||(14975094-14975152)
chr6 (19-80)||(9161197-9161258)
chr6 (18-74)||(3815084-3815140)
chr6 (16-80)||(10734906-10734970)
chr6 (20-80)||(23930128-23930188)
chr6 (17-80)||(3116130-3116193)
chr6 (25-80)||(26097237-26097292)
chr6 (18-80)||(24097649-24097711)
chr6 (19-80)||(2166411-2166472)
chr6 (19-80)||(2178044-2178105)
chr6 (28-80)||(25557805-25557857)
chr6 (16-71)||(11395831-11395886)
chr6 (18-80)||(383761-383823)
chr6 (18-79)||(15866041-15866102)
chr6 (28-77)||(30786378-30786427)
chr6 (16-68)||(7947384-7947436)
chr6 (13-80)||(9671085-9671152)
chr6 (17-80)||(17432419-17432482)
chr6 (18-80)||(18277194-18277256)
chr6 (18-64)||(32579497-32579543)
chr6 (18-80)||(34850608-34850670)
chr6 (16-65)||(11849124-11849173)
chr6 (16-72)||(19340898-19340954)
chr6 (21-79)||(23240826-23240884)
chr6 (22-80)||(33922858-33922916)
chr6 (18-79)||(15865859-15865920)
chr6 (48-80)||(25997751-25997783)
chr6 (26-62)||(29016301-29016337)
chr6 (18-70)||(33138905-33138957)
[»] chr8 (51 HSPs)
chr8 (21-80)||(27507985-27508044)
chr8 (18-80)||(12625962-12626024)
chr8 (18-80)||(35261751-35261813)
chr8 (19-80)||(28817627-28817688)
chr8 (19-80)||(39460995-39461056)
chr8 (18-80)||(13160773-13160835)
chr8 (18-80)||(17823648-17823710)
chr8 (18-80)||(26102589-26102651)
chr8 (18-80)||(28407475-28407537)
chr8 (18-80)||(30454098-30454160)
chr8 (18-80)||(36720868-36720930)
chr8 (18-80)||(44530221-44530283)
chr8 (18-80)||(45071336-45071398)
chr8 (19-80)||(25250597-25250658)
chr8 (19-75)||(20284075-20284131)
chr8 (19-75)||(21070703-21070759)
chr8 (18-80)||(8897765-8897827)
chr8 (18-80)||(12670251-12670313)
chr8 (18-80)||(31457244-31457306)
chr8 (18-80)||(35107312-35107374)
chr8 (19-80)||(6760897-6760958)
chr8 (19-80)||(7136528-7136589)
chr8 (19-80)||(20869998-20870059)
chr8 (18-79)||(29877166-29877227)
chr8 (32-80)||(27468093-27468141)
chr8 (21-80)||(10857904-10857963)
chr8 (17-80)||(16013527-16013590)
chr8 (18-80)||(5135291-5135352)
chr8 (18-76)||(5689703-5689761)
chr8 (18-76)||(29521690-29521748)
chr8 (19-80)||(16225094-16225155)
chr8 (33-77)||(18164764-18164808)
chr8 (32-80)||(33867038-33867086)
chr8 (20-80)||(36486567-36486627)
chr8 (16-80)||(42083699-42083763)
chr8 (19-78)||(17250879-17250937)
chr8 (18-80)||(19729412-19729474)
chr8 (19-80)||(26954208-26954269)
chr8 (17-77)||(18595909-18595969)
chr8 (18-70)||(24365071-24365122)
chr8 (21-72)||(8483947-8483998)
chr8 (17-68)||(44781517-44781568)
chr8 (18-80)||(2626594-2626656)
chr8 (16-78)||(44742521-44742583)
chr8 (17-62)||(24245520-24245565)
chr8 (40-80)||(30962772-30962812)
chr8 (49-80)||(23000229-23000260)
chr8 (25-80)||(40444845-40444900)
chr8 (30-80)||(40604907-40604957)
chr8 (18-71)||(389717-389770)
chr8 (40-80)||(23286338-23286378)
[»] chr7 (62 HSPs)
chr7 (18-80)||(7879710-7879772)
chr7 (21-80)||(18747562-18747621)
chr7 (18-80)||(2541020-2541082)
chr7 (18-80)||(21172010-21172072)
chr7 (18-80)||(27889317-27889379)
chr7 (18-80)||(32758331-32758393)
chr7 (18-80)||(38262197-38262259)
chr7 (18-80)||(42391101-42391163)
chr7 (18-80)||(48735123-48735185)
chr7 (19-80)||(42805599-42805660)
chr7 (19-79)||(18512455-18512515)
chr7 (16-72)||(21566506-21566562)
chr7 (19-79)||(35334818-35334878)
chr7 (21-80)||(45018924-45018983)
chr7 (18-80)||(10693074-10693136)
chr7 (18-80)||(11617589-11617651)
chr7 (16-81)||(29907490-29907553)
chr7 (18-80)||(31591110-31591172)
chr7 (18-80)||(34626209-34626271)
chr7 (18-80)||(40463948-40464010)
chr7 (19-80)||(23231630-23231691)
chr7 (19-80)||(47716534-47716595)
chr7 (18-80)||(27629706-27629768)
chr7 (18-80)||(35787270-35787332)
chr7 (18-80)||(42798741-42798803)
chr7 (19-80)||(43557547-43557609)
chr7 (16-77)||(47077859-47077920)
chr7 (40-80)||(36602541-36602581)
chr7 (17-69)||(39123966-39124018)
chr7 (18-77)||(33871914-33871973)
chr7 (18-80)||(13792151-13792213)
chr7 (18-68)||(21139761-21139811)
chr7 (17-78)||(33500586-33500645)
chr7 (17-81)||(3469175-3469239)
chr7 (17-80)||(22698968-22699032)
chr7 (18-73)||(38604598-38604654)
chr7 (30-78)||(42495865-42495913)
chr7 (18-77)||(1408529-1408588)
chr7 (17-80)||(14732822-14732885)
chr7 (18-80)||(11741865-11741927)
chr7 (18-80)||(19265886-19265947)
chr7 (18-80)||(19426891-19426952)
chr7 (18-80)||(23618978-23619040)
chr7 (18-80)||(32233136-32233198)
chr7 (33-71)||(36267827-36267865)
chr7 (18-62)||(28078151-28078195)
chr7 (17-69)||(47514792-47514843)
chr7 (18-61)||(13805173-13805216)
chr7 (18-57)||(14099030-14099069)
chr7 (18-57)||(14409047-14409086)
chr7 (29-72)||(24634233-24634276)
chr7 (18-60)||(19266522-19266564)
chr7 (18-80)||(23419675-23419737)
chr7 (18-76)||(25198798-25198856)
chr7 (40-70)||(25434114-25434144)
chr7 (18-80)||(42476943-42477005)
chr7 (50-80)||(44171638-44171668)
chr7 (18-80)||(45811919-45811980)
chr7 (23-80)||(11888414-11888471)
chr7 (16-85)||(16341349-16341418)
chr7 (17-62)||(35203512-35203557)
chr7 (21-66)||(42101899-42101944)
[»] scaffold0311 (1 HSPs)
scaffold0311 (18-76)||(10882-10940)
[»] scaffold0168 (1 HSPs)
scaffold0168 (18-80)||(30649-30711)
[»] scaffold0015 (1 HSPs)
scaffold0015 (18-80)||(48635-48697)
[»] scaffold0258 (1 HSPs)
scaffold0258 (19-80)||(13025-13086)
[»] scaffold0049 (1 HSPs)
scaffold0049 (17-80)||(59050-59113)
[»] scaffold0180 (1 HSPs)
scaffold0180 (18-80)||(24134-24196)
[»] scaffold0954 (1 HSPs)
scaffold0954 (19-80)||(3617-3678)
[»] scaffold1176 (1 HSPs)
scaffold1176 (18-77)||(1591-1650)
[»] scaffold0223 (1 HSPs)
scaffold0223 (18-80)||(11201-11263)
[»] scaffold0018 (1 HSPs)
scaffold0018 (18-80)||(72868-72930)
[»] scaffold0187 (2 HSPs)
scaffold0187 (18-79)||(10052-10113)
scaffold0187 (18-79)||(20380-20441)


Alignment Details
Target: chr4 (Bit Score: 148; Significance: 6e-78; HSPs: 79)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 171 - 414
Target Start/End: Complemental strand, 45961998 - 45961754
Alignment:
Q  171 aggatttagttg-ctattttgctagaaaattgtgctgccctatgagtttaagtgtacagacacacacttctacctaatctatattggaatgcaannnnnn 269  Q
    |||||||||||| ||||||||| |||||||||||||||| ||||| |||||||||||||||||||||| |||||||| ||||||||||||||||          
T  45961998 aggatttagttgtctattttgccagaaaattgtgctgccgtatgaatttaagtgtacagacacacactgctacctaagctatattggaatgcaatttttt 45961899  T
Q  270 ncccttttgatgaaagtgcaccaaggggtgtagctttattgaaggttagtattttttcttgttgcgtgtttcccgctacactgcatgttgattggtctaa 369  Q
     |||| ||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||| | |||||  ||||||||||||||||| ||||| |    
T  45961898 tccctcttgatgaaattgtaccaagggttgtagctttattgaaggttagtattttttcttgttgcatatttccttctacactgcatgttgatcggtctga 45961799  T
Q  370 gtacagattcagccatttagttagactggaaatttattctgaaat 414  Q
    ||||| ||||||||||||||||||| |||||||||||||||||||    
T  45961798 gtacacattcagccatttagttagattggaaatttattctgaaat 45961754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 20639723 - 20639659
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  20639723 caaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 20639659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 44363194 - 44363131
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  44363194 aaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 44363131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 38755970 - 38755909
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  38755970 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 38755909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 11394924 - 11394986
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||    
T  11394924 aaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 11394986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 11404651 - 11404713
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||    
T  11404651 aaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 11404713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 35567242 - 35567304
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||    
T  35567242 aaatggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgccctt 35567304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 23501862 - 23501923
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||    
T  23501862 aatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt 23501923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 33836549 - 33836488
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||    
T  33836549 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctt 33836488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 16 - 68
Target Start/End: Complemental strand, 20908701 - 20908649
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac 68  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20908701 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac 20908649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 16 - 76
Target Start/End: Original strand, 21489158 - 21489218
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgc 76  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||    
T  21489158 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtgcactgggttgc 21489218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 32484307 - 32484367
Alignment:
Q  20 atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||    
T  32484307 atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt 32484367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 40553998 - 40553938
Alignment:
Q  20 atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  40553998 atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 40553938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 7909344 - 7909281
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgc-gggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||    
T  7909344 aaatggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgcatcgggttgccctt 7909281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 30352644 - 30352581
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||    
T  30352644 aaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccctt 30352581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 5648330 - 5648392
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||    
T  5648330 aaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgccctt 5648392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 6430689 - 6430627
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||||||    
T  6430689 aaatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt 6430627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 20225054 - 20225116
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  20225054 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 20225116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 19 - 85
Target Start/End: Original strand, 20225149 - 20225215
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcccttcatgt 85  Q
    |||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||| ||||    
T  20225149 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttatgt 20225215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 25629121 - 25629183
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||||    
T  25629121 aaatggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttgccctt 25629183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 38786681 - 38786743
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  38786681 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 38786743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 25388249 - 25388310
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||||||  ||||||||||||||||||||||||||    
T  25388249 aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgccctt 25388310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 29207961 - 29207900
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    ||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||||||||    
T  29207961 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct 29207900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 30690236 - 30690177
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||    
T  30690236 tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgccctt 30690177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 14983906 - 14983968
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||| |||  |||||||||    
T  14983906 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 14983968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 30639451 - 30639513
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||| |||||||||||| ||||||| ||||||||||||||||||||| |||||||||||    
T  30639451 aaatggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgccctt 30639513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 40915900 - 40915962
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| ||||||||| ||||||||||||||||||||| |||||||||| ||||||||    
T  40915900 aaatggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgccctt 40915962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 8473685 - 8473621
Alignment:
Q  18 aaatggtgggaccccttccc--gaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||  || |||||| |||||||||||||||||||||||||||||||||    
T  8473685 aaatggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccctt 8473621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 23 - 80
Target Start/End: Complemental strand, 13256457 - 13256400
Alignment:
Q  23 gtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| || | |||||||||||||||||||||||||||||||    
T  13256457 gtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgccctt 13256400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 16408663 - 16408602
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||| ||||||||||| |||| || |||||||||||||||||||||||||||||||||    
T  16408663 aatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctt 16408602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 16911637 - 16911698
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||| ||||||||||||||  ||||||||||||||    
T  16911637 aatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgccctt 16911698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 35532077 - 35532126
Alignment:
Q  31 ccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||    
T  35532077 ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 35532126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 79 - 140
Target Start/End: Complemental strand, 45962233 - 45962173
Alignment:
Q  79 ttcatgtgagcgttgcagagttatggtaagtaaccattgatttcaaatgtataatacttgga 140  Q
    ||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||    
T  45962233 ttcatgtgagcgttgcagagttatggtaagtgaccattcatttc-aatgtataatacttgga 45962173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 16 - 80
Target Start/End: Original strand, 54175134 - 54175199
Alignment:
Q  16 caaaatggtgggaccccttccc-gaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||| |||||||    
T  54175134 caaaatggtgggaccccttccccggaccctgcatatgcgggagctttagtgcaccgggctgccctt 54175199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 44718641 - 44718701
Alignment:
Q  20 atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||  ||||||||||||||||||||||||  |||||||||||||||    
T  44718641 atggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgccctt 44718701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 21647039 - 21647098
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    |||||||||||||||||||  |||| || |||||||||||||||||||||||||||||||    
T  21647039 aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc 21647098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 32478854 - 32478788
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcccttcatgt 85  Q
    ||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||| |||||| ||||    
T  32478854 aaatggtgggaccccttcccggacccagcgtatgcgggagcttt-gtgcaccgggtggccctttatgt 32478788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 47482914 - 47482851
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||| |||||||||||||||||||||| ||||| || | |||||||    
T  47482914 aaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcaacgagctgccctt 47482851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 9832376 - 9832314
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| ||||| ||| || ||||||||||||||||||||    
T  9832376 aaatggtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgccctt 9832314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 11054211 - 11054149
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||| || ||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  11054211 aaatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 11054149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 16 - 78
Target Start/End: Original strand, 36589814 - 36589876
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    ||||||||||||||||||||| |||||||  ||||||||||||||| |||||||||| |||||    
T  36589814 caaaatggtgggaccccttcctgaaccctatgtatgcgggagctttggtgcaccgggctgccc 36589876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 47444029 - 47444091
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| ||||| ||||||| ||||||| |||||||||||    
T  47444029 aaatggtgggaccccttcccggaccctgcatatgcaggagcttcagtgcactgggttgccctt 47444091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 47528593 - 47528531
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||  |||| ||||||| ||||||||||||||||||||    
T  47528593 aaatggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgccctt 47528531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 48598888 - 48598826
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||| ||| ||||| |||||| ||||||||||||||||||||    
T  48598888 aaatggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgccctt 48598826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 49796869 - 49796911
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctt 60  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  49796869 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctt 49796911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 51865101 - 51865039
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||| |||||||||| ||||||||||||||||||||||| ||||||||  |||||||    
T  51865101 aaatggtggggccccttcccggaccctgcgtatgcgggagctttattgcaccggactgccctt 51865039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 5306727 - 5306661
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatg----cgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||||||||    ||||||||||| |||||||||||||||||    
T  5306727 aaatggtgggaccccttcccggaccctgcgtatgtggacgggagctttaatgcaccgggttgccctt 5306661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 20405162 - 20405223
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||| || ||||||||||||||||||||  |||||||||||    
T  20405162 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcattgggttgccctt 20405223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 50555718 - 50555657
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||| ||||||||||| ||||||||||||| |||| |||||||||||||| |||||||    
T  50555718 aatggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgccctt 50555657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 36816449 - 36816385
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||| |||||||| |||||| | |||||| ||||||||||||||||||| ||||||||||||||    
T  36816449 caaaaaggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgccctt 36816385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 54730325 - 54730376
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccg 70  Q
    |||| ||| ||||||||||| |||||||||||||||||||||||||||||||    
T  54730325 aatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccg 54730376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 2813200 - 2813262
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagcttt-agtgcaccgggttgccctt 80  Q
    ||||||||||||| |||||||||  |||||||||||||||||| |||||||||| ||||||||    
T  2813200 aatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgccctt 2813262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 55766528 - 55766467
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||| ||||| ||||| ||| |||||||||| |||||||||||||||||| |||||||    
T  55766528 aatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgggatgccctt 55766467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 54967092 - 54967151
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    ||||||||||||||||||||| ||||| | |||||||||||||| |||||||||| |||||    
T  54967092 aaatggtgggaccccttcccgtaccctacatatgcgggagcttt-gtgcaccgggctgccc 54967151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 19027986 - 19028045
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||| |||||||| ||||  | ||||||||||||||||||||||||| |||||||    
T  19027986 tggtgggactccttcccggaccccacttatgcgggagctttagtgcaccgggctgccctt 19028045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 25463194 - 25463237
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt 61  Q
    ||||||||||||||||||||| ||||||| ||||||||||||||    
T  25463194 aaatggtgggaccccttcccggaccctgcatatgcgggagcttt 25463237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 28494223 - 28494282
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||||||||||||||  | ||||| |||||||||||| |||||||||||| ||||    
T  28494223 aaatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgcc 28494282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 63
Target Start/End: Complemental strand, 49938658 - 49938611
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttag 63  Q
    ||||||||||||||||||||||  ||||||| ||||||||||||||||    
T  49938658 caaaatggtgggaccccttcccataccctgcatatgcgggagctttag 49938611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 56322984 - 56323034
Alignment:
Q  30 cccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||| |||| |  |||||||||||||||||||||||||||||||||    
T  56322984 cccttcccggaccccggatatgcgggagctttagtgcaccgggttgccctt 56323034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 30581530 - 30581481
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtg 65  Q
    ||||||||||||||||||||||| ||||||| ||||  ||||||||||||    
T  30581530 caaaatggtgggaccccttcccggaccctgcatatgtaggagctttagtg 30581481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 32 - 69
Target Start/End: Complemental strand, 37038172 - 37038135
Alignment:
Q  32 cttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    ||||||| ||||||||||||||||||||||||||||||    
T  37038172 cttcccgtaccctgcgtatgcgggagctttagtgcacc 37038135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 37494923 - 37494972
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgca 67  Q
    ||||||||||||||||| | | ||||||||||||| ||||||||||||||    
T  37494923 aaatggtgggacccctttcgggaccctgcgtatgcaggagctttagtgca 37494972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 48327825 - 48327764
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||| ||||||||||||  | ||||||| || |||||||||||||||| |||||    
T  48327825 aatggtgggacctcttcccgaaccccacatatgcggaagttttagtgcaccgggttaccctt 48327764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 55830783 - 55830722
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||| ||||| ||||| ||| |||||||||| ||||||||||||||| || |||||||    
T  55830783 aatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccaggatgccctt 55830722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 72
Target Start/End: Complemental strand, 487187 - 487135
Alignment:
Q  20 atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    |||| |||||||||||||| |  ||||| ||||||||||||||||||||||||    
T  487187 atggcgggaccccttcccggattctgcgaatgcgggagctttagtgcaccggg 487135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 80
Target Start/End: Original strand, 7038123 - 7038186
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||| | ||| |||| ||||||||||| ||| ||||||||||||| |||||||||||    
T  7038123 caaaatggtggggcacctacccggaccctgcgtatacgg-agctttagtgcactgggttgccctt 7038186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 67
Target Start/End: Original strand, 8820581 - 8820629
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgca 67  Q
    |||||||||||||||||||  |||||||||||||| ||| |||||||||    
T  8820581 aatggtgggaccccttcccagaccctgcgtatgcgagagttttagtgca 8820629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 80
Target Start/End: Complemental strand, 12666914 - 12666858
Alignment:
Q  24 tgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||  || ||| ||||||||| ||||||||||| |||||||||||||||    
T  12666914 tgggaccccttgtcggaccatgcgtatgcaggagctttagtacaccgggttgccctt 12666858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 9987897 - 9987838
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    |||||||||||||||||||   ||| ||| ||||||||||||||| ||||||||| ||||    
T  9987897 aaatggtgggaccccttccttgaccttgcatatgcgggagctttaatgcaccgggctgcc 9987838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 17 - 72
Target Start/End: Original strand, 16494290 - 16494345
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    ||||||||||||||| |||||  |||||| |||||||| |||||||||| ||||||    
T  16494290 aaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtgtaccggg 16494345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 44 - 79
Target Start/End: Complemental strand, 17315371 - 17315336
Alignment:
Q  44 tgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    ||||||||||||||||||||||||| ||||||||||    
T  17315371 tgcgtatgcgggagctttagtgcactgggttgccct 17315336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 39077859 - 39077800
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    |||||||| |||  ||| ||| ||||||| |||||||||||| |||||||||||||||||    
T  39077859 aaatggtgagacatctttccggaccctgcatatgcgggagctctagtgcaccgggttgcc 39077800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 21 - 71
Target Start/End: Original strand, 19027923 - 19027973
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgg 71  Q
    |||||||||||||| ||  || ||||||||| |||||||||||||||||||    
T  19027923 tggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccgg 19027973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 17 - 63
Target Start/End: Complemental strand, 39029124 - 39029078
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttag 63  Q
    |||||||||||||| ||| ||| ||||||| ||||||||||||||||    
T  39029124 aaaatggtgggaccactttccggaccctgcatatgcgggagctttag 39029078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 7385539 - 7385499
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagc 58  Q
    |||||||||||||| |||||| |||||| ||||||||||||    
T  7385539 aaatggtgggaccctttcccggaccctgtgtatgcgggagc 7385499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 17043457 - 17043413
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagcttta 62  Q
    ||||||||||||||||||||  ||||||| ||||| |||||||||    
T  17043457 aaatggtgggaccccttcccagaccctgcatatgctggagcttta 17043413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 44 - 80
Target Start/End: Original strand, 19425923 - 19425959
Alignment:
Q  44 tgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| |||||| ||||||||    
T  19425923 tgcgtatgcgggagctttagtacaccggattgccctt 19425959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 21003410 - 21003469
Alignment:
Q  20 atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||| |||| ||||||  ||||||||| |||||||||||| |||||||||| |||||||    
T  21003410 atggtgtgacctcttcccagaccctgcgtgtgcgggagcttt-gtgcaccgggctgccctt 21003469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 31 - 67
Target Start/End: Original strand, 48202395 - 48202431
Alignment:
Q  31 ccttcccgaaccctgcgtatgcgggagctttagtgca 67  Q
    |||| |||||||| |||||||||||||||||||||||    
T  48202395 ccttaccgaaccccgcgtatgcgggagctttagtgca 48202431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 141; Significance: 8e-74; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 169 - 420
Target Start/End: Original strand, 291834 - 292089
Alignment:
Q  169 ttaggatttagttg-ctattttgctagaaaattgtgctgccctatgagtttaagtgtacagacacacac------ttctacctaatctatattggaatgc 261  Q
    |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||      |||||||||||||||||||||||||    
T  291834 ttaggatttagttgtctattttgccagaaaattgtgctgccctatgagtttaagtgtacatacacacacacacacttctacctaatctatattggaatgc 291933  T
Q  262 aannnnnnncccttttgatgaaagtgcaccaaggggtgtagctttattgaaggttagtattttttcttgttgcgtgtttcccgctacactgcatgttgat 361  Q
    ||       |||| ||||||||||||||||||||| ||||||||||||||||||||   |||||||||| ||||| ||||| ||||||||||||||||||    
T  291934 aatttttttccctcttgatgaaagtgcaccaagggttgtagctttattgaaggtta---ttttttcttgctgcgtatttcctgctacactgcatgttgat 292030  T
Q  362 tggtctaagtacagattcagccatttagttagactggaaatttattctgaaattatttt 420  Q
     ||||| |||| ||||||||||||| ||||||| ||||||||||||||| |||||||||    
T  292031 cggtctgagtatagattcagccattaagttagattggaaatttattctgtaattatttt 292089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 60; Significance: 2e-25; HSPs: 62)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 10543771 - 10543834
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  10543771 aaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 10543834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 9671251 - 9671313
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  9671251 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 9671313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 10546235 - 10546297
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  10546235 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 10546297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 14530393 - 14530454
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  14530393 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 14530454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 8455379 - 8455317
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||    
T  8455379 aaatggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgccctt 8455317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 14444800 - 14444862
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||    
T  14444800 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccctt 14444862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 25249801 - 25249739
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  25249801 aaatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgccctt 25249739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 40579810 - 40579750
Alignment:
Q  20 atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||    
T  40579810 atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt 40579750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 76
Target Start/End: Original strand, 23488554 - 23488613
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgc 76  Q
    |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||    
T  23488554 aaaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgc 23488613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 21779324 - 21779262
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  21779324 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 21779262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 36871564 - 36871625
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||    
T  36871564 aaatggtgggaccccttcccggacc-tgcgtatgcgggagctttagtgcaccgggttgccctt 36871625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 25079779 - 25079718
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||||||  ||||||||||||||||||||||||||    
T  25079779 aatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgccctt 25079718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 34080176 - 34080235
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||| ||||||| |||||||||| ||||||||||||||||||||||    
T  34080176 tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgccctt 34080235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 34766330 - 34766389
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||    
T  34766330 tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtttccctt 34766389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 20 - 79
Target Start/End: Original strand, 41409936 - 41409995
Alignment:
Q  20 atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    ||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||    
T  41409936 atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct 41409995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 17668074 - 17668136
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||| |||||||| ||||||||||||||  ||||||||||||||||||||||||||||    
T  17668074 aaatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgccctt 17668136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 25632581 - 25632643
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||  |||||||||||| | |||||||||||||||||||||||||||||||||||    
T  25632581 aaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgccctt 25632643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 26684683 - 26684621
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||| ||||    
T  26684683 aaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattgtcctt 26684621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 40762297 - 40762235
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||| |||| | |||||||||||| ||||||||||||||||||||||||||||    
T  40762297 aaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcaccgggttgccctt 40762235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 44643595 - 44643657
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||  ||||||||||||||||||| ||||||||||||| |||||||    
T  44643595 aaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccctt 44643657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 5841103 - 5841164
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||| || ||||||||||||||||||||||| |||||||||    
T  5841103 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctt 5841164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 39914367 - 39914307
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||    
T  39914367 aatggtgggaccccttcctga-ccctgcgtatgcgggagctttagtgcatcgggttgccctt 39914307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 14544137 - 14544200
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||| ||||||||||| | ||||||||||||||||||||||||||||||  |||||||||    
T  14544137 aaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgccctt 14544200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 33 - 80
Target Start/End: Original strand, 22371199 - 22371246
Alignment:
Q  33 ttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||    
T  22371199 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 22371246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 24200687 - 24200624
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||| ||||||||| |||||| ||||| | ||||||||||||||||||||||||||    
T  24200687 aaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgccctt 24200624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 26 - 80
Target Start/End: Original strand, 8575975 - 8576029
Alignment:
Q  26 ggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||    
T  8575975 ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgccctt 8576029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 11514508 - 11514569
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||| |||||  |||||||||||||||||||||||||||||||| ||||||||    
T  11514508 aaatggtgggaccc-ttcccagaccctgcgtatgcgggagctttagtgcaccggattgccctt 11514569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 17623636 - 17623698
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||| ||||||||||||| |||||||||| || ||||||||||||| |||||||||||    
T  17623636 aaatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcactgggttgccctt 17623698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 17896332 - 17896394
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||| || |||||||||||| ||||||||||||||| || |||||||||    
T  17896332 aaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcatcgagttgccctt 17896394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 21377136 - 21377075
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||||||||||||||| ||||||||| |||||||| | |||||||    
T  21377136 aaatggtgggaccccttcccgaaccctgcgtatgtgggagcttt-gtgcaccgagctgccctt 21377075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 23397836 - 23397898
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||| || ||||| | |||||||||||| ||||||||||||||||||||    
T  23397836 aaatggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgccctt 23397898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 33 - 77
Target Start/End: Complemental strand, 124962 - 124918
Alignment:
Q  33 ttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    |||||| ||||||||||||||||||||||||||||||||||||||    
T  124962 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 124918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 31158503 - 31158451
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    |||||||||||||||||||||  ||||||||||||||||||||||||| ||||    
T  31158503 aaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtacacc 31158451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 26 - 69
Target Start/End: Original strand, 19615073 - 19615116
Alignment:
Q  26 ggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    ||||||||||||||||||||||||||| ||||||||||||||||    
T  19615073 ggaccccttcccgaaccctgcgtatgcaggagctttagtgcacc 19615116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 19977777 - 19977726
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    ||||||||||| ||||||||||||| || |||||||||||||||||||||||    
T  19977777 aaatggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcacc 19977726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 24860051 - 24859992
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||| | |||||||| || |||||||||||||||||||||||||||||||| |||||    
T  24860051 aaatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccggattgcc 24859992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 21 - 68
Target Start/End: Original strand, 24890486 - 24890533
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac 68  Q
    |||||||||||||||||| ||||||||||||| |||||||||||||||    
T  24890486 tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac 24890533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 13245158 - 13245096
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||| ||| ||| |||||||||||||| | ||||||||||||    
T  13245158 aaatggtgggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttgccctt 13245096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 25641573 - 25641635
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||| |||||||||||||||||| |||||||||||| ||||||||||| ||||| ||| ||||    
T  25641573 aaattgtgggaccccttcccgaatcctgcgtatgcgagagctttagtgaaccggattgtcctt 25641635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 3633762 - 3633709
Alignment:
Q  27 gaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||| |||| || ||||||||||||||||||||||| |||||||||    
T  3633762 gaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctt 3633709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 21 - 78
Target Start/End: Complemental strand, 4516411 - 4516354
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    |||||||||||||||||| |||||||||||| || |||||||||| |||||| |||||    
T  4516411 tggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtaccgggctgccc 4516354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 17 - 64
Target Start/End: Complemental strand, 19185807 - 19185760
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagt 64  Q
    |||||||||| ||||||||| | |||||||||||||||||||||||||    
T  19185807 aaaatggtggaaccccttcctggaccctgcgtatgcgggagctttagt 19185760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 73
Target Start/End: Original strand, 31523303 - 31523358
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggt 73  Q
    ||||||||| |||| ||||| |||||||| ||||||||||||||||||||| ||||    
T  31523303 aaatggtggaaccctttcccaaaccctgcatatgcgggagctttagtgcactgggt 31523358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 39499293 - 39499242
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    ||||||||||| |||||  |||| ||||||||||||||||||||||||||||    
T  39499293 aaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcacc 39499242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 1289095 - 1289157
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagc-tttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| | | ||| ||||||||||| ||||||||||||| ||||||||    
T  1289095 aatggtgggaccccttcccggatcatgcatatgcgggagcttttagtgcaccggattgccctt 1289157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 27573692 - 27573754
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||| |||  ||||| ||||||| ||||| ||||||||||||||| ||||||||||||    
T  27573692 aaatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgggttgccctt 27573754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 24059057 - 24059012
Alignment:
Q  20 atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtg 65  Q
    ||||||||||||||| ||| |||||||||||| |||||||||||||    
T  24059057 atggtgggacccctttccggaccctgcgtatgtgggagctttagtg 24059012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 80
Target Start/End: Complemental strand, 40416912 - 40416872
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||| |||||| ||||||||||||||||||||||||||    
T  40416912 accctgcatatgcgagagctttagtgcaccgggttgccctt 40416872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 16 - 71
Target Start/End: Original strand, 17471620 - 17471675
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgg 71  Q
    ||||||| || |||||||||||  ||||||| |||||||||| |||||||||||||    
T  17471620 caaaatgatgagaccccttccctgaccctgcctatgcgggagttttagtgcaccgg 17471675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 31821406 - 31821355
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    ||||| ||||||||||| ||||| |||| |||||||||||||||| ||||||    
T  31821406 aaatgatgggacccctttccgaaacctgtgtatgcgggagctttaatgcacc 31821355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 18 - 61
Target Start/End: Complemental strand, 32781351 - 32781308
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt 61  Q
    ||||||||||||||||||||  |||||| |||||||||||||||    
T  32781351 aaatggtgggaccccttcccagaccctgtgtatgcgggagcttt 32781308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 77
Target Start/End: Complemental strand, 39189555 - 39189508
Alignment:
Q  30 cccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||| |||| || |||||||||||| |||||||||||||||||    
T  39189555 cccttcccggaccccgcatatgcgggagctctagtgcaccgggttgcc 39189508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 4794874 - 4794924
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac 68  Q
    ||||| ||||||||||||||| | ||||| |||||||||||| ||||||||    
T  4794874 aaatgatgggaccccttcccggatcctgcatatgcgggagctctagtgcac 4794924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 16 - 78
Target Start/End: Complemental strand, 45235882 - 45235820
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    ||||||||||||||||||| ||  ||||| ||||||| |||||||||||| |||  |||||||    
T  45235882 caaaatggtgggaccccttaccagaccctacgtatgcaggagctttagtgtaccaagttgccc 45235820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 12023982 - 12023929
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgg 71  Q
    ||||||||||||||| ||||| |||||||||||  || ||||||| ||||||||    
T  12023982 aaatggtgggaccccctcccggaccctgcgtatttggaagctttaatgcaccgg 12023929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 33795359 - 33795400
Alignment:
Q  20 atggtgggaccccttcccgaaccctgcgtatgcgggagcttt 61  Q
    ||||||||||||||||||  |||||| |||||||||||||||    
T  33795359 atggtgggaccccttcccagaccctgtgtatgcgggagcttt 33795400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 44449448 - 44449395
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    |||||| |||||||||||||||| ||||||||| || ||||| |||| ||||||    
T  44449448 caaaatagtgggaccccttcccggaccctgcgtttgtgggagttttaatgcacc 44449395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 16 - 80
Target Start/End: Original strand, 4795825 - 4795889
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||  |||||| ||| || |||||| | ||||||||||||  |||||||||||    
T  4795825 caaaatggtgggaccttttcccggaccttgtgtatgccgaagctttagtgcagtgggttgccctt 4795889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 17 - 77
Target Start/End: Original strand, 7214607 - 7214667
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||| || |||||| || || ||||||||||| ||| ||||||||||| |||||||    
T  7214607 aaaatggtgagatcccttctcggacactgcgtatgcgagagttttagtgcaccaggttgcc 7214667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 27 - 67
Target Start/End: Complemental strand, 22363549 - 22363509
Alignment:
Q  27 gaccccttcccgaaccctgcgtatgcgggagctttagtgca 67  Q
    ||||| ||| ||||||||||||| |||||||||||||||||    
T  22363549 gaccctttctcgaaccctgcgtacgcgggagctttagtgca 22363509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 40 - 80
Target Start/End: Complemental strand, 23053006 - 23052966
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||| |||||||| |||||||||| |||||||    
T  23053006 accctgcgtatgcaggagcttttgtgcaccgggctgccctt 23052966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 31525778 - 31525838
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    ||||| |||||||| || ||  ||||||| |||||||||||||||||| ||||| ||||||    
T  31525778 aaatgatgggaccctttgccagaccctgcatatgcgggagctttagtgtaccggattgccc 31525838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 59; Significance: 7e-25; HSPs: 4)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 46903 - 46965
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  46903 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 46965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 24835 - 24773
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||    
T  24835 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggttgccctt 24773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 16 - 67
Target Start/End: Complemental strand, 46772 - 46721
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgca 67  Q
    ||||||||||||||||||||||  ||||||||||||||||||||||| ||||    
T  46772 caaaatggtgggaccccttcccagaccctgcgtatgcgggagctttaatgca 46721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 43729 - 43792
Alignment:
Q  18 aaatggtgggaccccttcc-cgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||| | || ||||||| |||||||||||| |||||||| | |||||||||    
T  43729 aaatggtgggacccctttctcggaccctgcatatgcgggagctctagtgcactgagttgccctt 43792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 59; Significance: 7e-25; HSPs: 60)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 16957386 - 16957448
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  16957386 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 16957448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 38879656 - 38879717
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  38879656 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 38879717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 24448962 - 24449024
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||    
T  24448962 aaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgccctt 24449024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 25622533 - 25622594
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||    
T  25622533 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctt 25622594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 43334276 - 43334338
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||    
T  43334276 aaaatggtgggaccccttcccggaccctgcg-atgcgggagctttagtgcaccgggttgccctt 43334338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 32703494 - 32703556
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  32703494 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 32703556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 7097823 - 7097772
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  7097823 aaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 7097772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 8170047 - 8169985
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||| || |||||||||||||||||||    
T  8170047 aaatggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgccctt 8169985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 22 - 80
Target Start/End: Complemental strand, 16028683 - 16028625
Alignment:
Q  22 ggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  16028683 ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 16028625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 27328827 - 27328885
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||| ||| |||||    
T  27328827 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgcatcggattgcc 27328885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 34154877 - 34154815
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| ||||||| |||| ||||||||||||||||||||    
T  34154877 aaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgccctt 34154815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 41014390 - 41014452
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||| | |||| || |||||||||||||||||||||||||||||||||    
T  41014390 aaatggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgccctt 41014452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 43574678 - 43574732
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    ||||||||||||||||||||| |||||||||||||||||||||||| ||||||||    
T  43574678 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagagcaccggg 43574732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 4619166 - 4619105
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||| || |||||| ||||||||||||||||||||||||||    
T  4619166 aatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgccctt 4619105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 12006390 - 12006329
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||  ||||||| ||||||||||||||||||||||| |||||||||    
T  12006390 aatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccgtgttgccctt 12006329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 13801829 - 13801768
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||| || |||||| ||||||||||||||||||||||||||    
T  13801829 aatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgccctt 13801768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 17 - 78
Target Start/End: Complemental strand, 21784396 - 21784335
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    |||||||||||||||||| ||| |||||||||||||||||| |||||||||||| |||||||    
T  21784396 aaaatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc 21784335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 12575725 - 12575661
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| | ||||||||||||| |||||||| |||||||||| |||||||    
T  12575725 caaaatggtgggaccccttcctggaccctgcgtatgcaggagctttggtgcaccgggctgccctt 12575661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 21 - 77
Target Start/End: Original strand, 39801591 - 39801647
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    |||||||||||||||||  ||||| ||||||||||||||||||||||||||||||||    
T  39801591 tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgcc 39801647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 10306539 - 10306493
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagcttta 62  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||    
T  10306539 caaaatggtgggaccccttcccggaccctgcgtatgcgggagcttta 10306493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 16880710 - 16880648
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||| |||| ||||||| ||| ||||||||||||||||||||||||||||||| |||||    
T  16880710 aaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccgggtttccctt 16880648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 22861732 - 22861670
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||| |||||||||| |||||||||||| ||||||||||  ||||||||    
T  22861732 aaatggtgggaccccttctcgaaccctgcatatgcgggagctctagtgcaccgaattgccctt 22861670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 22 - 80
Target Start/End: Complemental strand, 30877623 - 30877565
Alignment:
Q  22 ggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||| ||||||| |||| ||||||| ||||||||||||||||||||    
T  30877623 ggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccctt 30877565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 32354211 - 32354261
Alignment:
Q  30 cccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||    
T  32354211 cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctt 32354261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 35710383 - 35710445
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| | | ||| |||||||||||| ||||||||||||||||||||    
T  35710383 aaatggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgccctt 35710445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 4654480 - 4654427
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    ||||||||||||| |||||| |||||||||| ||||||||||||||||||||||    
T  4654480 caaaatggtgggatcccttctcgaaccctgcatatgcgggagctttagtgcacc 4654427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 21 - 78
Target Start/End: Original strand, 7368471 - 7368528
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    |||||||||||||||||| ||||||| |||| ||||||| ||||||||||||||||||    
T  7368471 tggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccc 7368528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 20135679 - 20135740
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||| || ||||| ||||||| |||||||||||||||||||    
T  20135679 aatggtgggaccccttcccggaccccgcatatgcaggagcttcagtgcaccgggttgccctt 20135740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 11657764 - 11657700
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||||||||||||  | |||||| ||||||| ||||||| |||||||    
T  11657764 caaaatggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgggctgccctt 11657700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 37226026 - 37225962
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||||||||| |||||||||  ||| |||||||||| || ||||||||    
T  37226026 caaaatggtgggaccccttcccgaaccatgcgtatgccagaggtttagtgcactggattgccctt 37225962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 3771414 - 3771473
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||| || ||| ||||| |||||||||||||||||||| |||||||    
T  3771414 tggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgccctt 3771473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 13 - 80
Target Start/End: Complemental strand, 28516501 - 28516434
Alignment:
Q  13 catcaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||| |||||  |||||||| |||| |||||||||||| ||| ||||||||||    
T  28516501 catcaaaatggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggttgccctt 28516434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 30006397 - 30006456
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    |||||||||||||||||||||   |||  |||||||||||||||||||||||||||||||    
T  30006397 aaatggtgggaccccttcccggggcctatgtatgcgggagctttagtgcaccgggttgcc 30006456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 1405259 - 1405321
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||| |||| ||||||||| |||||||||||| |||| |||||| ||||||||    
T  1405259 aaatggtgggaccctttcctgaaccctgcatatgcgggagctctagtacaccggattgccctt 1405321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 1565504 - 1565565
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||| |||||||||||||| ||||||| |||| |||||| |||||||||||||||||||||    
T  1565504 aaatggcgggaccccttcccggaccctgcatatgtgggagc-ttagtgcaccgggttgccctt 1565565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 19143006 - 19142956
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac 68  Q
    ||||||||||||||||||||| ||| |||||||||||||| ||||||||||    
T  19143006 aaatggtgggaccccttcccggaccatgcgtatgcgggagatttagtgcac 19142956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 29334469 - 29334530
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||| |||||| |||||||||||| |||| ||||| ||||||||| |||||||    
T  29334469 aatggtgggacccattcccggaccctgcgtatgtgggatctttaatgcaccgggctgccctt 29334530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 208992 - 208936
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    ||||||||||||||||||||| | |||||| ||||||  ||||||||||||||||||    
T  208992 caaaatggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccggg 208936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 44 - 80
Target Start/End: Complemental strand, 29184098 - 29184062
Alignment:
Q  44 tgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||||||||||||||||||    
T  29184098 tgcgtatgcgggagctttagtgcaccgggttgccctt 29184062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 5873382 - 5873323
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||| ||| |||| || ||||||||||||||||||||||||| |||| |||||||    
T  5873382 tggtgggactcctccccggacactgcgtatgcgggagctttagtgcatcgggatgccctt 5873323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 25 - 80
Target Start/End: Complemental strand, 10943900 - 10943846
Alignment:
Q  25 gggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||| |||||||  |||||||||||||||||||||||| |||||||    
T  10943900 gggaccccttcccggaccctgca-atgcgggagctttagtgcaccgggctgccctt 10943846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 19093884 - 19093947
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||  ||||||| |||| ||||||||||||  ||||||||||||||||||| |||||||    
T  19093884 aaaatggtatgacccctacccggaccctgcgtatgttggagctttagtgcaccgggctgccctt 19093947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 30 - 72
Target Start/End: Original strand, 13774949 - 13774991
Alignment:
Q  30 cccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    ||||| ||| |||||||||||||||||||||||||||||||||    
T  13774949 ccctttccggaccctgcgtatgcgggagctttagtgcaccggg 13774991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 9 - 59
Target Start/End: Complemental strand, 21542539 - 21542489
Alignment:
Q  9 acatcatcaaaatggtgggaccccttcccgaaccctgcgtatgcgggagct 59  Q
    |||| ||| ||||||||||||||||||||| || |||||||||||||||||    
T  21542539 acattatccaaatggtgggaccccttcccggactctgcgtatgcgggagct 21542489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 1850711 - 1850764
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgg 71  Q
    ||||||||||||| ||||| | |||||||| |||||| ||||||||||||||||    
T  1850711 aaatggtgggaccacttcctggaccctgcggatgcggaagctttagtgcaccgg 1850764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 34 - 79
Target Start/End: Original strand, 11462913 - 11462958
Alignment:
Q  34 tcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    |||||||| |||| |||||||||||| |||||||||||||||||||    
T  11462913 tcccgaactctgcatatgcgggagctctagtgcaccgggttgccct 11462958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 12477185 - 12477132
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    ||||||||||||||||||||||| |  ||||||||||  |||||||||||||||    
T  12477185 caaaatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc 12477132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 16 - 77
Target Start/End: Complemental strand, 39079816 - 39079755
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||||||||||||||||| ||| || |||| |||||| |||||||||| ||| ||||    
T  39079816 caaaatggtgggaccccttcccggaccatgtgtatacgggagttttagtgcacagggctgcc 39079755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 80
Target Start/End: Original strand, 18099955 - 18099995
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||||||||||| ||||| |||||    
T  18099955 accctgcgtatgcgggagctttagtgcactgggtttccctt 18099995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 76
Target Start/End: Original strand, 18684367 - 18684403
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgc 76  Q
    |||||||||||||||||||||||||||| ||||||||    
T  18684367 accctgcgtatgcgggagctttagtgcatcgggttgc 18684403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 39301194 - 39301249
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    ||||| ||||||||||||||||| ||||| |||||| ||||| ||||||||||||||    
T  39301194 caaaaaggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcaccggg 39301249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 22600526 - 22600569
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt 61  Q
    ||||||||||| ||||||||| | ||||||||||||||||||||    
T  22600526 aaatggtgggatcccttcccggatcctgcgtatgcgggagcttt 22600569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 64
Target Start/End: Original strand, 15141952 - 15141998
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagt 64  Q
    ||||||||||||||||||  ||||||||| ||| |||||||||||||    
T  15141952 aaatggtgggaccccttcttgaaccctgcttatacgggagctttagt 15141998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 22187368 - 22187421
Alignment:
Q  27 gaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| |||||| | ||||| |||||||||||||| | ||||||||||    
T  22187368 gaccccttcccaaaccctacatatgcaggagctttagtgcatcaggttgccctt 22187421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 24313638 - 24313573
Alignment:
Q  16 caaaatggtgggaccccttccc-gaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||| |  || || |||||| | ||||||||||||||||| |||||||    
T  24313638 caaaatggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgccctt 24313573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 24355975 - 24355910
Alignment:
Q  16 caaaatggtgggaccccttccc-gaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||| |  || || |||||| | ||||||||||||||||| |||||||    
T  24355975 caaaatggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgccctt 24355910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 58
Target Start/End: Original strand, 2838850 - 2838890
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagc 58  Q
    ||||||||||| |||||| || |||||||||||||||||||    
T  2838850 aaatggtgggatcccttctcggaccctgcgtatgcgggagc 2838890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 19 - 67
Target Start/End: Original strand, 18426112 - 18426160
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgca 67  Q
    ||||||| ||||||||  ||||| ||||||||||| |||||||||||||    
T  18426112 aatggtgagaccccttttcgaactctgcgtatgcgagagctttagtgca 18426160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 40 - 80
Target Start/End: Original strand, 19438760 - 19438800
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||| |||||||||||| ||||||||| ||||||||||    
T  19438760 accctgcatatgcgggagctctagtgcaccaggttgccctt 19438800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 40 - 80
Target Start/End: Complemental strand, 42924871 - 42924831
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||| |||||||||||||||| ||| ||||    
T  42924871 accctgcgtatgcggaagctttagtgcaccggattgtcctt 42924831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 59; Significance: 7e-25; HSPs: 64)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 40272875 - 40272813
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  40272875 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 40272813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 54484785 - 54484847
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  54484785 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 54484847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 13628852 - 13628791
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  13628852 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 13628791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 25517235 - 25517171
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||    
T  25517235 caaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgccctt 25517171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 516505 - 516568
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||| |||||||||||||  |||||||||||||||||||||||||||||||||||||||||    
T  516505 aaaatggcgggaccccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgccctt 516568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 829507 - 829452
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgg 71  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  829507 caaaatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccgg 829452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 5173783 - 5173720
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||    
T  5173783 aaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgccctt 5173720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 45786278 - 45786215
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||| |||||||| |||| |||||||||||||||||||||||||||    
T  45786278 aaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgcaccgggttgccctt 45786215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 22609859 - 22609921
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||    
T  22609859 aaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt 22609921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 24851364 - 24851302
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||    
T  24851364 aaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgccctt 24851302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 39203608 - 39203670
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||    
T  39203608 aaatggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgccctt 39203670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 52926282 - 52926220
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||    
T  52926282 aaatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt 52926220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 13730664 - 13730603
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||    
T  13730664 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctt 13730603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 29366782 - 29366721
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||    
T  29366782 aatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgccctt 29366721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 353411 - 353351
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    |||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||    
T  353411 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct 353351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 10795487 - 10795424
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| | ||||||||||||||||||||| |||||||| ||||||||||    
T  10795487 aaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccaggttgccctt 10795424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 30452892 - 30452951
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  30452892 tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 30452951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 1217182 - 1217244
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||| |||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  1217182 aaatggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 1217244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 80
Target Start/End: Complemental strand, 10484671 - 10484617
Alignment:
Q  26 ggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| | |||||||||||||||||||||||||||||||||||||||||    
T  10484671 ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 10484617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 15797314 - 15797376
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||| ||||||| ||||||||||||||||||||    
T  15797314 aaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccctt 15797376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 22122980 - 22122918
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||| ||||| ||||||||||||||||||||    
T  22122980 aaatggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgccctt 22122918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 26869800 - 26869862
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||| ||| ||| |||||||||||||||||| ||||||||||||||||||    
T  26869800 aaatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgccctt 26869862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 31592941 - 31593003
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||| |||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  31592941 aaatggtgggactccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 31593003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 34771427 - 34771365
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| |||||||||||| |||||||    
T  34771427 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgccctt 34771365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 46421097 - 46421035
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagcttt-agtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||||||    
T  46421097 aatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgccctt 46421035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 49013535 - 49013474
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||| || || ||||||||||||||||||||||||||||||    
T  49013535 aatggtgggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggttgccctt 49013474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 36 - 80
Target Start/End: Original strand, 40390353 - 40390397
Alignment:
Q  36 ccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  40390353 ccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 40390397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 53996630 - 53996566
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||||  || ||||||||| |||||||||||||||||||| |||||||    
T  53996630 caaaatggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgccctt 53996566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 14266431 - 14266373
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| |||| ||||||||||||||||||||||||||||||| |||||||||||    
T  14266431 tggtgggaccc-ttcctgaaccctgcgtatgcgggagctttagtgcactgggttgccctt 14266373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 33 - 80
Target Start/End: Original strand, 47624208 - 47624255
Alignment:
Q  33 ttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||    
T  47624208 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 47624255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 16735534 - 16735596
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| || |||||||||||| ||||| ||||||| |||||||||||    
T  16735534 aaatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgccctt 16735596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 21 - 71
Target Start/End: Complemental strand, 45948898 - 45948848
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgg 71  Q
    ||||||||||||||| || ||||||||||||||||||||||||||||||||    
T  45948898 tggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgg 45948848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 8247749 - 8247688
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagcttt-agtgcaccgggttgccct 79  Q
    ||||||||||| |||||||| |||||||||||||||||||||| ||||||| ||||||||||    
T  8247749 aatggtgggactccttcccggaccctgcgtatgcgggagctttaagtgcactgggttgccct 8247688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 14987054 - 14987115
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||| |||||| ||| ||| ||||||||||||||||||||||||||| |||||    
T  14987054 aatggtgggacccattcccggaccttgcatatgcgggagctttagtgcaccgggtttccctt 14987115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 16 - 77
Target Start/End: Complemental strand, 44403620 - 44403559
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||||||||||||||||| ||||| ||||||| | ||||||||||||||||| ||||    
T  44403620 caaaatggtgggaccccttcccggaccctacgtatgctgaagctttagtgcaccgggctgcc 44403559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 54374410 - 54374357
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    ||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||    
T  54374410 caaaatggtgggaccccttcccggaccctgcatatgcgggagctttagttcacc 54374357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 40 - 80
Target Start/End: Complemental strand, 4495717 - 4495677
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  4495717 accctgcgtatgcgggagctttagtgcaccgggttgccctt 4495677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 16 - 80
Target Start/End: Original strand, 25944562 - 25944626
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||||  |||||||||||| ||||||||||| ||||| || |||||||    
T  25944562 caaaatggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcaccaggctgccctt 25944626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 16 - 68
Target Start/End: Complemental strand, 34420708 - 34420656
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac 68  Q
    ||||||||||||||||||||||| ||| |||||||| ||||||||||||||||    
T  34420708 caaaatggtgggaccccttcccggaccttgcgtatgtgggagctttagtgcac 34420656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 40 - 80
Target Start/End: Complemental strand, 54032612 - 54032572
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  54032612 accctgcgtatgcgggagctttagtgcaccgggttgccctt 54032572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 12914098 - 12914036
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||| |||||||||||  ||||||| ||||||||||||| | |||||||||||||||||    
T  12914098 aaatggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgccctt 12914036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 26292424 - 26292486
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||| ||||| ||||||||||||||||| ||||||||| || ||||||||||||||| ||||    
T  26292424 aaatgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggttgtcctt 26292486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 26573224 - 26573282
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    |||||||||||| ||||| |||||||||||||| ||||||||||||||| || ||||||    
T  26573224 tggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccaggctgccct 26573282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 6411885 - 6411833
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccg 70  Q
    ||||| ||||||||||||||  ||| |||||||||||||||||||||||||||    
T  6411885 aaatgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg 6411833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 7943084 - 7943143
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||||| ||||| ||  ||| ||||||||||||||||||||||||| ||||||||    
T  7943084 aaatggtgggatccctttccagaccatgcgtatgcgggagctttagtgcactgggttgcc 7943143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 42 - 80
Target Start/End: Original strand, 23871484 - 23871522
Alignment:
Q  42 cctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||| |||||||||||||||||||||||    
T  23871484 cctgcgtatgcgggaactttagtgcaccgggttgccctt 23871522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 16 - 77
Target Start/End: Original strand, 55401269 - 55401330
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    |||||||||||||||||||| || ||| | ||||||||||||||||  ||||||||| ||||    
T  55401269 caaaatggtgggaccccttctcggaccttccgtatgcgggagcttttttgcaccgggctgcc 55401330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 35417998 - 35418058
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    ||||||||||||||||||||| |||| ||  ||||| ||||||||||||| |||| |||||    
T  35417998 aaatggtgggaccccttcccggaccccgcaaatgcgagagctttagtgcatcgggctgccc 35418058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 80
Target Start/End: Complemental strand, 43956513 - 43956473
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||| |||||||||||||||||||||||||||| |||||||    
T  43956513 acccagcgtatgcgggagctttagtgcaccgggctgccctt 43956473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 45139540 - 45139479
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| |  ||||||||||||||| |||| |||||||||| |||||||    
T  45139540 aaaatggtgggaccccttccc-agacctgcgtatgcgggaacttt-gtgcaccgggctgccctt 45139479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 25 - 80
Target Start/End: Complemental strand, 45288111 - 45288056
Alignment:
Q  25 gggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||| ||||||| |||||||||||||  ||||||||||||||| || |||||||    
T  45288111 gggacctcttcccggaccctgcgtatgcaagagctttagtgcaccaggctgccctt 45288056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 50625013 - 50624954
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||| |||||| |  ||||||||| | |||||||||||||||||||| |||||||    
T  50625013 tggtgggacgccttcctgggccctgcgtaagtgggagctttagtgcaccgggctgccctt 50624954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 24577929 - 24577991
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| || |||||  ||||||| ||| |||||||| ||||||||||| ||||||||    
T  24577929 aaatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgccctt 24577991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 24578019 - 24578081
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||| | |||||  ||||| | ||||||||| || ||||||||||||||||||||    
T  24578019 aaatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgccctt 24578081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 40 - 86
Target Start/End: Original strand, 31831302 - 31831348
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgcccttcatgtg 86  Q
    ||||||| |||||||| ||| |||||||||||||||||||| |||||    
T  31831302 accctgcatatgcgggtgctctagtgcaccgggttgccctttatgtg 31831348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 65
Target Start/End: Original strand, 33926178 - 33926224
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtg 65  Q
    |||||||||||||||||| | ||||||| |||||| |||||||||||    
T  33926178 aatggtgggaccccttcctggaccctgcatatgcgagagctttagtg 33926224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 35 - 80
Target Start/End: Complemental strand, 6242331 - 6242286
Alignment:
Q  35 cccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||| ||||||| ||||| |||||| ||||||||||||||||||||    
T  6242331 cccggaccctgcatatgcaggagctctagtgcaccgggttgccctt 6242286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 43114931 - 43114882
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgca 67  Q
    |||||||||||||| | |  || |||||||||||||||||||||||||||    
T  43114931 aaatggtgggacccttcctggacccctgcgtatgcgggagctttagtgca 43114882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 46170030 - 46169981
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgca 67  Q
    ||||||| ||||||||||||| ||||||| |||| |||||||| ||||||    
T  46170030 aaatggtaggaccccttcccggaccctgcatatgtgggagcttcagtgca 46169981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 51644074 - 51644127
Alignment:
Q  27 gaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||| | |||||| ||||||| |||||||||||||||| | |||||||    
T  51644074 gaccccttcctggaccctgggtatgcgagagctttagtgcaccgcggtgccctt 51644127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 16 - 68
Target Start/End: Complemental strand, 10696278 - 10696226
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac 68  Q
    ||||| ||||||||||||||||  ||||||||| | ||||||| |||||||||    
T  10696278 caaaagggtgggaccccttcccagaccctgcgtctacgggagcattagtgcac 10696226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 21 - 77
Target Start/End: Original strand, 19731099 - 19731155
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||||| |||||  || ||| |||||| ||||||||||||||||||| ||||    
T  19731099 tggtgggaccctttcccagactctgtgtatgcaggagctttagtgcaccgggctgcc 19731155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 28 - 80
Target Start/End: Complemental strand, 45416986 - 45416935
Alignment:
Q  28 accccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| ||||||||||||| | |||||| |||||||||| |||||||    
T  45416986 accccttcccggaccctgcgtatgcagaagcttt-gtgcaccgggctgccctt 45416935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 28 - 72
Target Start/End: Complemental strand, 52428523 - 52428479
Alignment:
Q  28 accccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    |||||||| || ||||| |||||| ||||||||||||||||||||    
T  52428523 accccttctcggaccctacgtatgtgggagctttagtgcaccggg 52428479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 59; Significance: 7e-25; HSPs: 69)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 4349733 - 4349795
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  4349733 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 4349795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 35005219 - 35005282
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||    
T  35005219 aaaatggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgcaccgggttgccctt 35005282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 50606497 - 50606560
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||    
T  50606497 aaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt 50606560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 46248016 - 46247954
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||    
T  46248016 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgccctt 46247954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 10668323 - 10668384
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||    
T  10668323 aatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgccctt 10668384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 27474376 - 27474437
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||    
T  27474376 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctt 27474437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 45402191 - 45402251
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||    
T  45402191 aaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgccc 45402251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 42304271 - 42304208
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||||||    
T  42304271 aaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgccctt 42304208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 46991900 - 46991959
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    |||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||    
T  46991900 aatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgccc 46991959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 18944741 - 18944803
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagc-tttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||    
T  18944741 aatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctt 18944803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 19414532 - 19414594
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  19414532 aaatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctt 19414594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 34725161 - 34725099
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  34725161 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 34725099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 18742021 - 18741958
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||  |||||||||||||| |||||||||||||||||||| |||||    
T  18742021 aaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttccctt 18741958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 27201743 - 27201806
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||| ||| ||||||||||||||||||||||||  |||||||||||    
T  27201743 aaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttgccctt 27201806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 45812600 - 45812541
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    |||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||    
T  45812600 aaatggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgcc 45812541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 4587626 - 4587568
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgc 76  Q
    ||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||    
T  4587626 aaatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc 4587568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 6925196 - 6925254
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||    
T  6925196 aatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgagttgcc 6925254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 14617133 - 14617195
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||| |||||    
T  14617133 aaatggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggttaccctt 14617195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 35253250 - 35253188
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||| ||||||||    
T  35253250 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctt 35253188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 19701664 - 19701717
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    |||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
T  19701664 caaaatggtggggccccttcccggaccctgcgtatgcgggagctttagtgcacc 19701717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 20004152 - 20004091
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||  |||| || |||||||||||||||||||||||||||||||||    
T  20004152 aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt 20004091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 30395788 - 30395727
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||| || ||||||||||||||||||||||| |||||||||    
T  30395788 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctt 30395727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 9939557 - 9939621
Alignment:
Q  17 aaaatggtgggacccc-ttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||| |||||    
T  9939557 aaaatggtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccgggttaccctt 9939621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 15505659 - 15505710
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccg 70  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  15505659 aaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt-gtgcaccg 15505710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 1517371 - 1517312
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||| |  ||||||||||||| |||||||||||||||||||||||||||    
T  1517371 tggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgccctt 1517312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 30555210 - 30555264
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    |||||||||||||||||| || |||||||||||||| ||||||||||||||||||    
T  30555210 aaatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccggg 30555264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 31382277 - 31382215
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||| | ||||||| ||||||||||||||| || ||||||||||||||    
T  31382277 aaatggtgggaccccttcctggaccctgcatatgcgggagctttactgtaccgggttgccctt 31382215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 32632620 - 32632558
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||| ||||||||||||| |||||||| |||| |||||    
T  32632620 aaatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcaccaggtttccctt 32632558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 38478345 - 38478283
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||| |||||||| || ||||||| |||||||||||| ||||||||||||||||||||    
T  38478345 aaatggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggttgccctt 38478283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 16 - 78
Target Start/End: Complemental strand, 39215023 - 39214961
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    |||||||||||| ||||||||| ||||||||||||| || ||||||||||||||||| |||||    
T  39215023 caaaatggtgggtccccttcccaaaccctgcgtatgtggaagctttagtgcaccgggctgccc 39214961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 25554796 - 25554743
Alignment:
Q  27 gaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||||||||||||| ||||||||||||  |||||||    
T  25554796 gaccccttcccgaaccctgcgtatgcgggagcattagtgcaccggactgccctt 25554743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 10378798 - 10378738
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    ||||||||||||||||||  | ||||||| ||||||||||||||||||||||||| |||||    
T  10378798 aaatggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgccc 10378738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 2435851 - 2435796
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgg 71  Q
    ||||||||||||||||||| ||| ||||| || |||||||||||||||||||||||    
T  2435851 caaaatggtgggacccctttccgtaccctccgcatgcgggagctttagtgcaccgg 2435796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 16 - 79
Target Start/End: Complemental strand, 15511213 - 15511150
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    ||||||||||| ||||||||| | |||||||||||| | |||||||||||||||||| ||||||    
T  15511213 caaaatggtggtaccccttcctggaccctgcgtatgtgtgagctttagtgcaccgggctgccct 15511150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 21 - 68
Target Start/End: Complemental strand, 33594191 - 33594144
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac 68  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||    
T  33594191 tggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcac 33594144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 43768237 - 43768296
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||  ||||||||||| ||||||||||| ||||||||| |||||||    
T  43768237 tggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgccctt 43768296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 6983874 - 6983812
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||| ||| |||||||||| || |||||||| |||||||||| |||||||    
T  6983874 aaatggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgggctgccctt 6983812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 8197138 - 8197200
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||| |||||||||| || ||||||||||||  |||||||||||| ||||||||||||||    
T  8197138 aaatggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttgccctt 8197200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 12126900 - 12126838
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||| |||||||||||||||| ||||||| |||||||||||| |||||||| | |||||||||    
T  12126900 aaattgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcactgcgttgccctt 12126838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 17 - 79
Target Start/End: Complemental strand, 19932817 - 19932755
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    |||||||||||||||||||||| |||||||||||||  || | |||||||||| |||||||||    
T  19932817 aaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgccct 19932755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 20999913 - 20999851
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||| |||| |||||||| | |||||||||| |||||||||||||||||||||| |||||||    
T  20999913 aaatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgggctgccctt 20999851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 23768383 - 23768325
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgc 76  Q
    |||||||||||| |||||||  |||||||||||||||||||||||||||| ||| ||||    
T  23768383 aaatggtgggacaccttcccagaccctgcgtatgcgggagctttagtgcagcggattgc 23768325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 23796560 - 23796622
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||| |||||||||||  ||||||| ||||| ||||||||||||||||||| |||||||    
T  23796560 aaatggtgagaccccttcccagaccctgcatatgctggagctttagtgcaccgggctgccctt 23796622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 16 - 74
Target Start/End: Complemental strand, 31442454 - 31442396
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggtt 74  Q
    ||||||||||||||||||||||| || ||| ||||| ||||||||| ||||||||||||    
T  31442454 caaaatggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccgggtt 31442396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 41319869 - 41319807
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||| ||||||||||||||||||||| | |||||||||| || ||||||| |||||||||||    
T  41319869 aaatgatgggaccccttcccgaacccttcatatgcgggagtttcagtgcactgggttgccctt 41319807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 34 - 80
Target Start/End: Complemental strand, 50760287 - 50760241
Alignment:
Q  34 tcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||||||||||| ||||||||| |||||||    
T  50760287 tcccgaaccctgcgtatgcgggagctttaatgcaccgggctgccctt 50760241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 45264464 - 45264411
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    |||||||||||||||||||| |  ||||||| ||||||||||||||||||||||    
T  45264464 caaaatggtgggaccccttctcagaccctgcatatgcgggagctttagtgcacc 45264411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 35117830 - 35117774
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgt-atgcgggagctttagtgcaccggg 72  Q
    |||||| ||||||||||||||| ||||||||| |||| |||||||||||||||||||    
T  35117830 aaaatgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccggg 35117774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 16 - 80
Target Start/End: Original strand, 50812034 - 50812097
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| |||||||||||  |||||||||||||||||||||| ||||| ||| |||||||    
T  50812034 caaaatggtgg-accccttcccgcgccctgcgtatgcgggagctttaatgcactgggctgccctt 50812097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 4249506 - 4249455
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    ||||||||||| ||||||||||||| || |||||||||||||||| ||||||    
T  4249506 aaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc 4249455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 4249830 - 4249779
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    ||||||||||| ||||||||||||| || |||||||||||||||| ||||||    
T  4249830 aaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc 4249779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 4250154 - 4250103
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    ||||||||||| ||||||||||||| || |||||||||||||||| ||||||    
T  4250154 aaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc 4250103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 11596607 - 11596650
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt 61  Q
    ||||||||||||||||||| | ||||||||||||||||||||||    
T  11596607 aaatggtgggaccccttcctggaccctgcgtatgcgggagcttt 11596650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 30682907 - 30682950
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt 61  Q
    ||||||||||||||||||||| ||| ||||||||||||||||||    
T  30682907 aaatggtgggaccccttcccggaccgtgcgtatgcgggagcttt 30682950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 47214604 - 47214655
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    ||||||||||||||||||||  ||||||| |||||||||||| |||||||||    
T  47214604 aaatggtgggaccccttcccagaccctgcatatgcgggagctctagtgcacc 47214655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 17 - 79
Target Start/End: Original strand, 22324988 - 22325049
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    ||||||||||  |||| |||||| ||||||||||||||||||||||||||||| || ||||||    
T  22324988 aaaatggtggagccccgtcccga-ccctgcgtatgcgggagctttagtgcaccaggctgccct 22325049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 16 - 65
Target Start/End: Original strand, 6358215 - 6358264
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtg 65  Q
    ||||||||||||||||||||||  ||||||||||||| ||| ||||||||    
T  6358215 caaaatggtgggaccccttcccagaccctgcgtatgcaggatctttagtg 6358264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 19974139 - 19974075
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||| |||||||| |||||| || ||  |||||||||||||||||||||| ||| |||||||    
T  19974139 caaaatgatgggacccattcccggactctatgtatgcgggagctttagtgcacggggctgccctt 19974075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 21 - 77
Target Start/End: Original strand, 35019328 - 35019383
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||||||| || || ||||||||||||| |||||||||||||||||| ||||    
T  35019328 tggtgggacccctcccaga-ccctgcgtatgcgagagctttagtgcaccgggctgcc 35019383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 26 - 80
Target Start/End: Original strand, 16120819 - 16120873
Alignment:
Q  26 ggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||  |||||| ||||||||||||||| |||||| || |||||||    
T  16120819 ggaccccttcccggcccctgcatatgcgggagctttaatgcaccaggctgccctt 16120873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 20036316 - 20036369
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    ||||||||| ||||||||||| ||||||||||||| |||| ||| ||||||||||    
T  20036316 aaatggtggaaccccttcccggaccctgcgtatgcaggag-ttttgtgcaccggg 20036369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 23371218 - 23371271
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    ||||| ||||||||||||| || ||||||||||| || |||||||||||||||||    
T  23371218 aaatgctgggaccccttccaga-ccctgcgtatgtggtagctttagtgcaccggg 23371271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 44485172 - 44485119
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    ||||||| ||||||||||||| | ||| |||||||||||||||| ||||||||||    
T  44485172 aaatggttggaccccttcccggatcctacgtatgcgggagcttt-gtgcaccggg 44485119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 79
Target Start/End: Complemental strand, 34679254 - 34679217
Alignment:
Q  42 cctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    ||||||||||||||||||||||| ||||||| ||||||    
T  34679254 cctgcgtatgcgggagctttagtacaccgggctgccct 34679217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 21910712 - 21910673
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagc 58  Q
    ||||||||||||||||||||||||||| ||| |||||||||    
T  21910712 aaatggtgggaccccttcccgaaccctacgt-tgcgggagc 21910673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 33 - 77
Target Start/End: Original strand, 22327206 - 22327250
Alignment:
Q  33 ttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||| ||| ||||||||||||||| |||||||||| ||||    
T  22327206 ttcccgaactctgtgtatgcgggagctttggtgcaccgggctgcc 22327250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 40 - 80
Target Start/End: Original strand, 24564451 - 24564491
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||| ||||| ||||| |||||||||||||||||||||    
T  24564451 accctgcctatgcaggagcgttagtgcaccgggttgccctt 24564491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 40 - 80
Target Start/End: Complemental strand, 31272422 - 31272382
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||||||| || ||| |||||||    
T  31272422 accctgcgtatgcgggagctttagtggactgggctgccctt 31272382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 41440667 - 41440603
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| |||||||||   || ||| ||||||||||||||||||| |||||  |||||||    
T  41440667 caaaatggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctt 41440603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 58; Significance: 3e-24; HSPs: 37)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 29355917 - 29355856
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  29355917 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 29355856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 6808468 - 6808529
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||    
T  6808468 aatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctt 6808529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 12885984 - 12886047
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||  |||||||||||| ||||||||||||||||||||||||||||    
T  12885984 aaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctt 12886047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 1347034 - 1347096
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  1347034 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 1347096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 1354820 - 1354758
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  1354820 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 1354758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 12221977 - 12221915
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagc-tttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||    
T  12221977 aatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctt 12221915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 13267797 - 13267859
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||    
T  13267797 aaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgccctt 13267859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 12892082 - 12892143
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||    
T  12892082 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctt 12892143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 14975152 - 14975094
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||    
T  14975152 aatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc 14975094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 9161197 - 9161258
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||| || ||||||||||||||| |||||||||||||| ||||||||||    
T  9161197 aatggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgccctt 9161258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 3815140 - 3815084
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggtt 74  Q
    |||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||    
T  3815140 aaatggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgggtt 3815084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 10734970 - 10734906
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||| ||||||| |||||||||| ||||||||||||||||||||||||| ||||||| |||||||    
T  10734970 caaagtggtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgccctt 10734906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 23930188 - 23930128
Alignment:
Q  20 atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||| || ||||||| ||||||||||||||||||||||| |||||||||    
T  23930188 atggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccctt 23930128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 3116193 - 3116130
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||| || ||| ||||||||||||||||||||| |||||| ||||||||    
T  3116193 aaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgccctt 3116130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 25 - 80
Target Start/End: Original strand, 26097237 - 26097292
Alignment:
Q  25 gggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  26097237 gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 26097292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 24097649 - 24097711
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||||||||||| ||||||||||  || ||||||||||    
T  24097649 aaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgtcccaggttgccctt 24097711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 2166472 - 2166411
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||   ||| |||||||||||||||||||||||||||||    
T  2166472 aatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctt 2166411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 2178105 - 2178044
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||   ||| |||||||||||||||||||||||||||||    
T  2178105 aatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctt 2178044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 28 - 80
Target Start/End: Original strand, 25557805 - 25557857
Alignment:
Q  28 accccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  25557805 accccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 25557857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 16 - 71
Target Start/End: Original strand, 11395831 - 11395886
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgg 71  Q
    |||| |||||||||||||||||| | ||||||||||||||||||||||| ||||||    
T  11395831 caaagtggtgggaccccttcccggatcctgcgtatgcgggagctttagtccaccgg 11395886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 383823 - 383761
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||| ||||||||||||| |  ||||||||||||||||||||| ||| |||||||||||||||    
T  383823 aaattgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgccctt 383761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 15866102 - 15866041
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    ||||||||||||||||||||| ||||||||| ||||||| || |||||||| | ||||||||    
T  15866102 aaatggtgggaccccttcccggaccctgcgtttgcgggatctatagtgcactgagttgccct 15866041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 28 - 77
Target Start/End: Complemental strand, 30786427 - 30786378
Alignment:
Q  28 accccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||| | ||| ||||||||||||||||||||||||||||||||||    
T  30786427 accccttcctggaccgtgcgtatgcgggagctttagtgcaccgggttgcc 30786378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 16 - 68
Target Start/End: Complemental strand, 7947436 - 7947384
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac 68  Q
    |||||||||||| |||||||||| ||| |||||||| ||||||||||||||||    
T  7947436 caaaatggtgggcccccttcccggaccttgcgtatgtgggagctttagtgcac 7947384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 13 - 80
Target Start/End: Complemental strand, 9671152 - 9671085
Alignment:
Q  13 catcaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||| ||||||||| |||||||||||  || ||||||||||| |||| |||| |||||||    
T  9671152 catcaaaatggtaggacccctttccgaaccctgcaaatacgggagctttaatgcatcgggctgccctt 9671085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 17432419 - 17432482
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||| ||||  |||||| | |||| | ||||||||||||||||||||||||||||||||    
T  17432419 aaaatggtgagaccttttcccggatcctgtgcatgcgggagctttagtgcaccgggttgccctt 17432482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 18277256 - 18277194
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||   || || ||||||||||||||||| |||||||||||| ||||    
T  18277256 aaatggtgggaccccttcctagactctacgtatgcgggagctttactgcaccgggttgtcctt 18277194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 64
Target Start/End: Original strand, 32579497 - 32579543
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagt 64  Q
    ||||||||||||||||||||  ||||||| |||||||||||||||||    
T  32579497 aaatggtgggaccccttcccagaccctgcatatgcgggagctttagt 32579543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 34850608 - 34850670
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||| ||||||||||||| |||||||||   |||||||||||||| ||||||| ||||    
T  34850608 aaatggtggaaccccttcccgaatcctgcgtatataggagctttagtgcatcgggttgtcctt 34850670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 16 - 65
Target Start/End: Original strand, 11849124 - 11849173
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtg 65  Q
    |||||||||||||||||||||||||| ||||||||| | || ||||||||    
T  11849124 caaaatggtgggaccccttcccgaactctgcgtatgtgagatctttagtg 11849173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 19340898 - 19340954
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    ||||||| ||||||||||||| | |||| |||||||||| |||||||||||| ||||    
T  19340898 caaaatgatgggaccccttcctggacccggcgtatgcggaagctttagtgcaacggg 19340954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 23240884 - 23240826
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    |||||||||||||||  | ||  ||||||||||||||||||||||||| ||| ||||||    
T  23240884 tggtgggaccccttctaggacaatgcgtatgcgggagctttagtgcactgggctgccct 23240826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 22 - 80
Target Start/End: Complemental strand, 33922916 - 33922858
Alignment:
Q  22 ggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||| ||||||||||| ||||||| ||||  |||||||||||||||  ||||||||||    
T  33922916 ggtggcaccccttcccggaccctgcttatgttggagctttagtgcacatggttgccctt 33922858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 15865920 - 15865859
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    ||||||||||||||||||| | ||||||||| |||| || || |||||||| | ||||||||    
T  15865920 aaatggtgggaccccttcctggaccctgcgtttgcgtgatctatagtgcactgagttgccct 15865859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 48 - 80
Target Start/End: Original strand, 25997751 - 25997783
Alignment:
Q  48 tatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||| ||||||||||||||||||||    
T  25997751 tatgcgggagctctagtgcaccgggttgccctt 25997783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 26 - 62
Target Start/End: Complemental strand, 29016337 - 29016301
Alignment:
Q  26 ggaccccttcccgaaccctgcgtatgcgggagcttta 62  Q
    ||||||||||||  |||||||||||||||||||||||    
T  29016337 ggaccccttcccagaccctgcgtatgcgggagcttta 29016301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 33138905 - 33138957
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccg 70  Q
    |||||||||||||| || ||| |||||| |||||| | |||||||||||||||    
T  33138905 aaatggtgggacccttttccggaccctgtgtatgcagtagctttagtgcaccg 33138957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 56; Significance: 4e-23; HSPs: 51)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 27507985 - 27508044
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  27507985 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcctt 27508044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 12625962 - 12626024
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||    
T  12625962 aaatggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 12626024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 35261751 - 35261813
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||    
T  35261751 aaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 35261813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 28817688 - 28817627
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||    
T  28817688 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgccctt 28817627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 39461056 - 39460995
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  39461056 aatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 39460995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 13160773 - 13160835
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||    
T  13160773 aaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgccctt 13160835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 17823648 - 17823710
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||    
T  17823648 aaatggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccgggttgccctt 17823710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 26102589 - 26102651
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  26102589 aaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccctt 26102651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 28407475 - 28407537
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||    
T  28407475 aaatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgccctt 28407537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 30454160 - 30454098
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  30454160 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 30454098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 36720868 - 36720930
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||    
T  36720868 aaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgccctt 36720930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 44530221 - 44530283
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||    
T  44530221 aaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgacctt 44530283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 45071336 - 45071398
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||    
T  45071336 aaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt 45071398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 25250597 - 25250658
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||||||| || |||||||||| ||||||||||||||||||||||    
T  25250597 aatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgccctt 25250658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 20284131 - 20284075
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttg 75  Q
    |||||||||||||||||||| |||||||||||||||||| |||||||||||||||||    
T  20284131 aatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg 20284075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 21070759 - 21070703
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttg 75  Q
    |||||||||||||||||||| |||||||||||||||||| |||||||||||||||||    
T  21070759 aatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg 21070703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 8897827 - 8897765
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| ||||||||||||||| |||||| ||||||||||    
T  8897827 aaatggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgccctt 8897765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 12670313 - 12670251
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||| |||||    
T  12670313 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttaccctt 12670251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 31457244 - 31457306
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||| |||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||    
T  31457244 aaatggtaggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgccctt 31457306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 35107374 - 35107312
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| || ||| |||||||| |||||||||||||||||||||||||    
T  35107374 aaatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgccctt 35107312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 6760897 - 6760958
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||| || |||| || |||||||||||||||||||||||||||||||||    
T  6760897 aatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgccctt 6760958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 7136589 - 7136528
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||| || ||||||||||||||||||||||||||| |||||    
T  7136589 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttaccctt 7136528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 20869998 - 20870059
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||| | |||| || |||||||||||||||||||||||||||||||||    
T  20869998 aatggtgggaccccttccaggaccccgcatatgcgggagctttagtgcaccgggttgccctt 20870059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 29877166 - 29877227
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    ||||||||||||||||||||| ||||||||||||||||||| |||||||||| || ||||||    
T  29877166 aaatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcaccaggctgccct 29877227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 32 - 80
Target Start/End: Complemental strand, 27468141 - 27468093
Alignment:
Q  32 cttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||    
T  27468141 cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 27468093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 10857904 - 10857963
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||| ||||| | ||| |||||||||||||||||||||||||||||||||||||    
T  10857904 tggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccgggttgccctt 10857963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 16013527 - 16013590
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||| |||||||||||  ||||||| |||||||||||||||||||||||||||| ||||    
T  16013527 aaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtcctt 16013590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 5135352 - 5135291
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||||||||| |||||||| |||||||||| |||||||    
T  5135352 aaatggtgggaccccttcccggaccctgcgtatgcaggagcttt-gtgcaccgggctgccctt 5135291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 5689703 - 5689761
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgc 76  Q
    ||||||||| ||||||||||||||| |||||||| ||||||||||||||||||| ||||    
T  5689703 aaatggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcaccggtttgc 5689761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 29521748 - 29521690
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgc 76  Q
    ||||||||||| ||| ||||  |||||||||||||||||||||||||||||||||||||    
T  29521748 aaatggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccgggttgc 29521690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 16225094 - 16225155
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||| ||||||||| |||| || |||||||||||||||||||||||||||| ||||    
T  16225094 aatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgggttgtcctt 16225155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 33 - 77
Target Start/End: Complemental strand, 18164808 - 18164764
Alignment:
Q  33 ttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    |||||| ||||||||||||||||||||||||||||||||||||||    
T  18164808 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 18164764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 32 - 80
Target Start/End: Original strand, 33867038 - 33867086
Alignment:
Q  32 cttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| | |||||||||||||||||||||||||    
T  33867038 cttcccgaaccctgcgtatgcagaagctttagtgcaccgggttgccctt 33867086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 36486627 - 36486567
Alignment:
Q  20 atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| ||||||| ||| ||||||||| ||||||||||||| |||||||||||||    
T  36486627 atggtgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgccctt 36486567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 42083763 - 42083699
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||||||||||| ||| | |||||||||||||||  ||| |||||||    
T  42083763 caaaatggtgggaccccttcccgaaccctgtgtacgtgggagctttagtgcattgggctgccctt 42083699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 17250937 - 17250879
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    ||||||||||||| |||||||||||||||||||  |||||||||||||| ||||||||||    
T  17250937 aatggtgggaccctttcccgaaccctgcgtatgaaggagctttagtgca-cgggttgccc 17250879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 19729412 - 19729474
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| ||| |||||||| |||||||| || ||||||||    
T  19729412 aaatggtgggaccccttcccggaccctgcatatacgggagctctagtgcactggattgccctt 19729474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 26954208 - 26954269
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||  |||  || ||||||||||||||||||||| |||||||||||    
T  26954208 aatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcactgggttgccctt 26954269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 17 - 77
Target Start/End: Original strand, 18595909 - 18595969
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    |||||| | ||||||||||||| |||||| ||||||||||| ||||||||| |||||||||    
T  18595909 aaaatgataggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgcc 18595969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 24365122 - 24365071
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccg 70  Q
    ||||||||||||||||||||| |||||||||||| ||||||||| ||||||||    
T  24365122 aaatggtgggaccccttcccggaccctgcgtatgtgggagcttt-gtgcaccg 24365071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 21 - 72
Target Start/End: Complemental strand, 8483998 - 8483947
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    |||||||||||| ||||  |||||||||||||||||||||||| ||||||||    
T  8483998 tggtgggaccccatcccagaccctgcgtatgcgggagctttagggcaccggg 8483947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 17 - 68
Target Start/End: Complemental strand, 44781568 - 44781517
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac 68  Q
    |||||| ||||||||| ||||  |||||||||||||||||||||||||||||    
T  44781568 aaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcac 44781517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 2626594 - 2626656
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||| ||||||||||||||  ||||||| ||||||||||||| |||||||| | ||||||||    
T  2626594 aaatgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgccctt 2626656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 16 - 78
Target Start/End: Complemental strand, 44742583 - 44742521
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    ||||||||||||||||||||  | ||||| || |||||||||| ||||||||||||| |||||    
T  44742583 caaaatggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccggggtgccc 44742521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 17 - 62
Target Start/End: Original strand, 24245520 - 24245565
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagcttta 62  Q
    ||||| |||||||||||||| | |||||||||||||||||||||||    
T  24245520 aaaattgtgggaccccttcctggaccctgcgtatgcgggagcttta 24245565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 80
Target Start/End: Complemental strand, 30962812 - 30962772
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||| ||||||| ||||||||||||||    
T  30962812 accctgcgtatgcgggagatttagtgaaccgggttgccctt 30962772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 49 - 80
Target Start/End: Complemental strand, 23000260 - 23000229
Alignment:
Q  49 atgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||||||||||||||    
T  23000260 atgcgggagctttagtgcaccgggttgccctt 23000229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 25 - 80
Target Start/End: Original strand, 40444845 - 40444900
Alignment:
Q  25 gggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||| ||| ||||||||||||  ||||||||||||||||| | |||||||    
T  40444845 gggaccccttgccggaccctgcgtatgttggagctttagtgcaccgagctgccctt 40444900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 40604957 - 40604907
Alignment:
Q  30 cccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||  |||||| |||||||||||||||||||||||||  ||||||||    
T  40604957 cccttccgaaaccctacgtatgcgggagctttagtgcaccgaattgccctt 40604907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 389717 - 389770
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgg 71  Q
    ||||| ||||| ||||| ||  |||||||||||||| |||||||||||||||||    
T  389717 aaatgatgggatccctttcctgaccctgcgtatgcgagagctttagtgcaccgg 389770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 40 - 80
Target Start/End: Complemental strand, 23286378 - 23286338
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||| |||||||||||| |||||||||||| |||||||    
T  23286378 accctgcatatgcgggagctctagtgcaccgggctgccctt 23286338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 55; Significance: 2e-22; HSPs: 62)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 7879710 - 7879772
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||    
T  7879710 aaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttgccctt 7879772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 18747562 - 18747621
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||    
T  18747562 tggtgggaccccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgccctt 18747621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 2541082 - 2541020
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||  |||||||||||||||||||||||||||||||||| |||||    
T  2541082 aaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtttccctt 2541020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 21172072 - 21172010
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  21172072 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 21172010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 27889379 - 27889317
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||    
T  27889379 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccctt 27889317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 32758331 - 32758393
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  32758331 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 32758393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 38262259 - 38262197
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||| |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||    
T  38262259 aaatgatgggaccccttcccgaacactgcgtatgcgggagctttagtgcaccggattgccctt 38262197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 42391163 - 42391101
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  42391163 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 42391101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 48735185 - 48735123
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  48735185 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 48735123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 42805599 - 42805660
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||    
T  42805599 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctt 42805660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 18512515 - 18512455
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    |||||||||||||||||||| |||||||||||||||||||||| |||||| ||||||||||    
T  18512515 aatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcactgggttgccct 18512455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 21566506 - 21566562
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||    
T  21566506 caaaatggtaggaccccttcccgaaccctgcatatgcgggagctttagtgcaccggg 21566562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 35334878 - 35334818
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||    
T  35334878 aatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtttccct 35334818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 45018983 - 45018924
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||||    
T  45018983 tggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccctt 45018924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 10693136 - 10693074
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| |||||||| |||||||||||    
T  10693136 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgccctt 10693074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 11617651 - 11617589
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||| | ||||||||||||| ||| |||||||||||||||||||||||    
T  11617651 aaatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgccctt 11617589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 16 - 81
Target Start/End: Original strand, 29907490 - 29907553
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcccttc 81  Q
    ||||||||||||||||| ||||| ||||||  ||||||||||||||||||||||||||||||||||    
T  29907490 caaaatggtgggaccccatcccggaccctg--tatgcgggagctttagtgcaccgggttgcccttc 29907553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 31591172 - 31591110
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||| ||| |||||||||||| ||||||||||||||||||||    
T  31591172 aaatggtgggaccccttcccggaccttgcatatgcgggagctctagtgcaccgggttgccctt 31591110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 34626271 - 34626209
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| ||||||||| ||||||||||||||||||||||||| || ||||||||||||    
T  34626271 aaatggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgccctt 34626209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 40463948 - 40464010
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||| || ||||||||||||||||||||| ||||||||| |||||||||    
T  40463948 aaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgccctt 40464010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 23231630 - 23231691
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||    
T  23231630 aatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccgagtttccctt 23231691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 47716534 - 47716595
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||| |||| || |||||||||||||| ||||||||||||||||||    
T  47716534 aatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgccctt 47716595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 27629706 - 27629768
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||  |||||| ||||||| ||||| |||||||||||||||||||    
T  27629706 aaatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgccctt 27629768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 35787332 - 35787270
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||| |||||||||||||| ||| ||||||||||||||||| | |||||||||||||||||    
T  35787332 aaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgggttgccctt 35787270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 42798741 - 42798803
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||| |||||| ||||||| |||||||||||| ||||||| ||||||||||||    
T  42798741 aaatggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgccctt 42798803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 43557547 - 43557609
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagc-tttagtgcaccgggttgccctt 80  Q
    |||||||||||||| ||||| || |||||||||||||||| ||||||||||||||||||||||    
T  43557547 aatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgccctt 43557609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 16 - 77
Target Start/End: Complemental strand, 47077920 - 47077859
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    |||||||||||||||||||||| |||||| | |||||||||||| ||||||||||| |||||    
T  47077920 caaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtgcaccggattgcc 47077859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 40 - 80
Target Start/End: Original strand, 36602541 - 36602581
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  36602541 accctgcgtatgcgggagctttagtgcaccgggttgccctt 36602581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 39123966 - 39124018
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    |||||||||||||||||||||| |||||||||||| ||||||||| |||||||    
T  39123966 aaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc 39124018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 33871973 - 33871914
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||||||||||||||  |||||| ||||||| ||||||||||||||| |||||||    
T  33871973 aaatggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgcc 33871914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 13792213 - 13792151
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||| ||||||||||| |||||||||||||||| |||||||| |||||||| | |||||||    
T  13792213 aaatggcgggaccccttctcgaaccctgcgtatgctggagcttttgtgcaccgagctgccctt 13792151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 21139811 - 21139761
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac 68  Q
    |||||||||||||||||||||||| ||| |||||||| |||||||||||||    
T  21139811 aaatggtgggaccccttcccgaactctgtgtatgcggaagctttagtgcac 21139761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 17 - 78
Target Start/End: Original strand, 33500586 - 33500645
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    |||||||||||||||||||||| ||||||||||||||||| ||| ||||  |||||||||||    
T  33500586 aaaatggtgggaccccttcccggaccctgcgtatgcgggatcttcagtg--ccgggttgccc 33500645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 17 - 81
Target Start/End: Complemental strand, 3469239 - 3469175
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcccttc 81  Q
    ||||||| ||||||||||||   |||||| |||||||||||||||||||| | ||||||||||||    
T  3469239 aaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgcgctgggttgcccttc 3469175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 22699032 - 22698968
Alignment:
Q  17 aaaatggtgggacccctt-cccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||| || |||| |||||| ||||||||||||| |||||||||||||| |||||    
T  22699032 aaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgggttaccctt 22698968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 18 - 73
Target Start/End: Original strand, 38604598 - 38604654
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt-agtgcaccgggt 73  Q
    |||||||| |||||||| ||| |||||||||||||||||||||| ||||||||||||    
T  38604598 aaatggtgagacccctttccggaccctgcgtatgcgggagctttaagtgcaccgggt 38604654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 42495913 - 42495865
Alignment:
Q  30 cccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccc 78  Q
    ||||||||| ||||||||||||||||||||||||||||||  |||||||    
T  42495913 cccttcccggaccctgcgtatgcgggagctttagtgcaccccgttgccc 42495865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 1408529 - 1408588
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||||||||||||||||||| ||||||||||||| | | ||||||| |||||| |||||    
T  1408529 aaatggtgggaccccttcccggaccctgcgtatgcagaatctttagttcaccggattgcc 1408588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 14732885 - 14732822
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||  || |||||||||||||||  |||||||||||||||||||||||| ||| ||||    
T  14732885 aaaatggtgaaactccttcccgaaccctgtttatgcgggagctttagtgcaccggattgtcctt 14732822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 11741865 - 11741927
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| ||||||||| |  ||||  ||||||||||| ||||||||||||||||||||    
T  11741865 aaatggtgggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgccctt 11741927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 19265886 - 19265947
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||| | | |||| |||||||||||||||||||| |||||||    
T  19265886 aaatggtgggaccccttcccggacc-tacatatgtgggagctttagtgcaccgggctgccctt 19265947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 19426952 - 19426891
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||| ||| || ||||||| |||||| |||||| |||||||||||||||||||    
T  19426952 aaatggtgggaccc-ttctcggaccctgcatatgcgagagcttcagtgcaccgggttgccctt 19426891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 23619040 - 23618978
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||| |  ||| ||||| ||| |||||||||||||| ||||||||||||    
T  23619040 aaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgccctt 23618978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 32233198 - 32233136
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||  ||||||| |||||||| |||| |||||||| ||||||||||| |||||||    
T  32233198 aaatggtgggattccttcccaaaccctgcatatgagggagcttcagtgcaccgggctgccctt 32233136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 33 - 71
Target Start/End: Complemental strand, 36267865 - 36267827
Alignment:
Q  33 ttcccgaaccctgcgtatgcgggagctttagtgcaccgg 71  Q
    ||||||||||||| |||||||||||||||||||||||||    
T  36267865 ttcccgaaccctgtgtatgcgggagctttagtgcaccgg 36267827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 28078195 - 28078151
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagcttta 62  Q
    ||||||||||||||||||||||| ||||| |||||| ||||||||    
T  28078195 aaatggtgggaccccttcccgaatcctgcatatgcgagagcttta 28078151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 47514792 - 47514843
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 69  Q
    ||||||||||||| | |||||||||||||||||| ||| ||||||||||||||    
T  47514792 aaaatggtgggactcattcccgaaccctgcgtat-cggaagctttagtgcacc 47514843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 13805173 - 13805216
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt 61  Q
    ||||||||||||| ||||| | ||||||||||||||||||||||    
T  13805173 aaatggtgggaccacttcctggaccctgcgtatgcgggagcttt 13805216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 14099069 - 14099030
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggag 57  Q
    ||||||||||||||||||||||||||| ||||||| ||||    
T  14099069 aaatggtgggaccccttcccgaaccctacgtatgcaggag 14099030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 14409086 - 14409047
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggag 57  Q
    ||||||||||||||||||||||||||| ||||||| ||||    
T  14409086 aaatggtgggaccccttcccgaaccctacgtatgcaggag 14409047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 29 - 72
Target Start/End: Original strand, 24634233 - 24634276
Alignment:
Q  29 ccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg 72  Q
    ||||||||||||||||| ||||| || |||||||||||||||||    
T  24634233 ccccttcccgaaccctgtgtatgtggaagctttagtgcaccggg 24634276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 19266522 - 19266564
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctt 60  Q
    |||| |||||| ||||||||| |||||||||||||||||||||    
T  19266522 aaattgtgggatcccttcccggaccctgcgtatgcgggagctt 19266564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 23419737 - 23419675
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||   ||| ||||| |||||| ||||||||||| |||| |||||||    
T  23419737 aaatggtgggaccccttcctagaccttgcgtgtgcgggggctttagtgcatcgggctgccctt 23419675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 25198798 - 25198856
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgc 76  Q
    ||||||| ||| ||||||||  ||||| |||||| | ||||||||||||||||||||||    
T  25198798 aaatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcaccgggttgc 25198856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 40 - 70
Target Start/End: Original strand, 25434114 - 25434144
Alignment:
Q  40 accctgcgtatgcgggagctttagtgcaccg 70  Q
    |||||||||||||||||||||||||||||||    
T  25434114 accctgcgtatgcgggagctttagtgcaccg 25434144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 42476943 - 42477005
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||    | |||| |||||||||||| ||||||||| ||||||||||    
T  42476943 aaatggtgggaccccttcctaggctctgcatatgcgggagctctagtgcaccaggttgccctt 42477005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 50 - 80
Target Start/End: Complemental strand, 44171668 - 44171638
Alignment:
Q  50 tgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||||||||||||    
T  44171668 tgcgggagctttagtgcaccgggttgccctt 44171638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 45811919 - 45811980
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||| ||||| ||  ||||||| ||||| |||||||||||||| ||||||||||||    
T  45811919 aaatggtgggatccctttccagaccctgcttatgcaggagctttagtgca-cgggttgccctt 45811980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 80
Target Start/End: Original strand, 11888414 - 11888471
Alignment:
Q  23 gtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||| | | |||||| |||||| ||||||| ||||||| |||||||||||    
T  11888414 gtgggacccctttctggaccctgtgtatgcaggagcttcagtgcactgggttgccctt 11888471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 85
Target Start/End: Original strand, 16341349 - 16341418
Alignment:
Q  16 caaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcccttcatgt 85  Q
    |||||||||||| || ||||||| |||   | |||||||||||||| |||||||||| ||||||| ||||    
T  16341349 caaaatggtgggccctcttcccggacctatcatatgcgggagctttggtgcaccgggctgcccttaatgt 16341418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 17 - 62
Target Start/End: Original strand, 35203512 - 35203557
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagcttta 62  Q
    |||||||||||| ||||||| |||| || |||||||||||||||||    
T  35203512 aaaatggtgggatcccttcctgaactctacgtatgcgggagcttta 35203557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 66
Target Start/End: Complemental strand, 42101944 - 42101899
Alignment:
Q  21 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgc 66  Q
    ||||||||||| |||||| ||||||||||| ||| |||||||||||    
T  42101944 tggtgggaccctttcccggaccctgcgtatccggcagctttagtgc 42101899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0311 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold0311
Description:

Target: scaffold0311; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 10882 - 10940
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgc 76  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||    
T  10882 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcactgggttgc 10940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 30649 - 30711
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  30649 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 30711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 48697 - 48635
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||    
T  48697 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 48635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0258 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0258
Description:

Target: scaffold0258; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 13086 - 13025
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||  |||||||||||||||| ||||||||||||||||||||||||    
T  13086 aatggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgccctt 13025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 59050 - 59113
Alignment:
Q  17 aaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||||||||||||  || ||||||||||||||||||||||||| ||||||||||||    
T  59050 aaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgccctt 59113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 24196 - 24134
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||||||||||||||||| ||||||| |||||||||||| ||||||||||| ||||||||    
T  24196 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctt 24134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0954 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0954
Description:

Target: scaffold0954; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 3617 - 3678
Alignment:
Q  19 aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||    
T  3617 aatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccgagtttccctt 3678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1176 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold1176
Description:

Target: scaffold1176; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 1650 - 1591
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgcc 77  Q
    ||||| ||||||||||||||| |||| ||||||||||||||||||||||||| |||||||    
T  1650 aaatgatgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgcc 1591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 11201 - 11263
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    |||||||||||| |||||||| ||||||| |||||||||||| ||||||||| ||||||||||    
T  11201 aaatggtgggacaccttcccggaccctgcatatgcgggagctctagtgcaccaggttgccctt 11263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 72930 - 72868
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctt 80  Q
    ||||||| | ||||||||||| | |||||||||||||||||||||||||||| ||||||||||    
T  72930 aaatggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggttgccctt 72868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0187
Description:

Target: scaffold0187; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 10113 - 10052
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    |||| |||||||||||||||| ||||||| ||||| ||||||  ||||||||||||||||||    
T  10113 aaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct 10052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 20441 - 20380
Alignment:
Q  18 aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgccct 79  Q
    |||| |||||||||||||||| ||||||| ||||| ||||||  ||||||||||||||||||    
T  20441 aaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct 20380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University