View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18537_high_27 (Length: 335)
Name: NF18537_high_27
Description: NF18537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18537_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 49208930 - 49208615
Alignment:
| Q |
1 |
ttatattggaatatatgtgacattgagattgaagctgtgaatatggttggagaaggagctttatacgagaaattaacgacgatgattacctcggatcatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
49208930 |
ttatattggaatatatgtgacattgagattgaagctgtgaatatggttggagaaggagctttatacgagaaactaacgacgatgtttacctcggatcatg |
49208831 |
T |
|
| Q |
101 |
catcggttgtgtcgctaaacatatttgttgctcttctttgtacttgcatcgtcattggtcatttgttggaggagaaccgttggattaatgaatccatcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49208830 |
catcggttgtgtcgctaaacatatttgttgctcttctttgtacttgcatcgtcattggtcatttgttggaggagaaccgttggattaatgaatccatcac |
49208731 |
T |
|
| Q |
201 |
tgctcttctcattgtaagtactaagtagtaatattatgttcttcatcaataatcaatatactatgctttcattgtatgatatattattgatggcatggca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49208730 |
tgctcttctcattgtaagtactaagtagtaatattatgttcttcatcaataatcaatatactatgctttcattgtatgatatattattgatggcatggca |
49208631 |
T |
|
| Q |
301 |
gggtttgtgtactggg |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
49208630 |
gggtttgtgtactggg |
49208615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University