View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18537_high_38 (Length: 239)
Name: NF18537_high_38
Description: NF18537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18537_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 78 - 221
Target Start/End: Complemental strand, 22783312 - 22783169
Alignment:
| Q |
78 |
aaacttccaaaatgtacataaatcattgggattatgaacatcaaagctatgacccttgtagcatagctaatcctctagaggacatatcagcaataattca |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22783312 |
aaacttccaaaatgtacataaatcattgggattatgaacatcaaagctatgaaccttgtagcatagctaatcctctagaggacatatcagcaataattca |
22783213 |
T |
 |
| Q |
178 |
tgaatcaaatgcaaatgaaacctatatgaattttcaagctcaac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22783212 |
tgaatcaaatgcaaatgaaacctatatgaattttcaagctcaac |
22783169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 22783414 - 22783342
Alignment:
| Q |
5 |
tgggtagattattctatatctttggcatataaaaggaacaaaacaagtgaagtgaagtaacccctttcacacaa |
78 |
Q |
| |
|
||||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22783414 |
tgggtagcttcttctatatctttggcatataaa-ggaacaaaacaagtgaagtgaagtaacccctttcacacaa |
22783342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University