View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18537_high_40 (Length: 237)
Name: NF18537_high_40
Description: NF18537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18537_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 116 - 228
Target Start/End: Original strand, 40292009 - 40292121
Alignment:
| Q |
116 |
ggctcaaggagggacagaaattgaatttaagaaagtaacaacaaaaattgcattagagaaacagaaacaaactacacaccaggtaccatggaacctcttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40292009 |
ggctcaaggagggacagaaattgaatttaagaaaataacaacaaaaattgcattagagaaacagaaacaaactacacaccaggtaccatggaacctcttt |
40292108 |
T |
 |
| Q |
216 |
tggaattgatgat |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40292109 |
tggaattgatgat |
40292121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 40291876 - 40291909
Alignment:
| Q |
1 |
gcaccacatgcacacgatcagtcccgtcatcctt |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40291876 |
gcaccacatgcacacgatcagtcccgtcatcctt |
40291909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University