View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18537_low_17 (Length: 372)
Name: NF18537_low_17
Description: NF18537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18537_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 69 - 358
Target Start/End: Complemental strand, 40820269 - 40819980
Alignment:
| Q |
69 |
tatacagatagaaacttctattgctcgaatgaggcttgatcgttgccattacctccaaaaatcaaacatttttgttgccgtttactccagttttgccttc |
168 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40820269 |
tatacagatagaaacttctgttgctcgaatgaggcttgatcgttgccattacctccaaaaatcaaacatttttgttgccgtttactccagttttgccttc |
40820170 |
T |
 |
| Q |
169 |
ccaccagattcaacttccaccatggaggtgtccttttccaaatgacatgtgtgatgtgtgataatgcagtagagtatgatattcacatgttctttggatg |
268 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40820169 |
ccaccagattcaacctccaccatggaggtgttcttttccaaatgacatgtgtgatgtgtgataatgcagtagagtatgatattcacatgttctttggata |
40820070 |
T |
 |
| Q |
269 |
tgctcaccacaaagattgttggaatgcaacaaacttgtggagcgaaattcgtctggaagttcccgaattatttttcaatattgttgctgg |
358 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40820069 |
tgctcactacaaagattgttggaatgcaacaaacttgtggagcgaaattcgtctggaagttcccgaattatttttcaatattgttgctgg |
40819980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University