View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18537_low_19 (Length: 366)

Name: NF18537_low_19
Description: NF18537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18537_low_19
NF18537_low_19
[»] chr8 (4 HSPs)
chr8 (1-348)||(29372920-29373269)
chr8 (227-278)||(10642960-10643011)
chr8 (227-278)||(32712827-32712878)
chr8 (242-283)||(11682092-11682133)
[»] scaffold0586 (1 HSPs)
scaffold0586 (227-278)||(3534-3585)
[»] chr7 (2 HSPs)
chr7 (227-278)||(23923638-23923689)
chr7 (242-283)||(23923520-23923561)
[»] chr1 (1 HSPs)
chr1 (141-202)||(17257070-17257131)
[»] chr4 (1 HSPs)
chr4 (134-202)||(43441337-43441405)


Alignment Details
Target: chr8 (Bit Score: 311; Significance: 1e-175; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 348
Target Start/End: Original strand, 29372920 - 29373269
Alignment:
1 tgaagagaggttatgtgtttatttcgcatgccgttctttgggttatttggagataacaaaatgggagaattttcaatgataaaggaaaggatattgatga 100  Q
    |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29372920 tgaagataggttatgtgtttatttggcatgccgttctttgggttatttggagataacaaaatgggagaattttcaatgataaaggaaaggatattgatga 29373019  T
101 ggttgttgaagaaatcaagcttgtttcatagcattggactttgagtagattgaagattgtttatggcctcttttattagtggtgttggaacccgagggag 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||    
29373020 ggttgttgaagaaatcaagcttgtttcatagcattggactttgagtagattgaagattgtttatggcctcttttatgagtggtgttggaacctgagagag 29373119  T
201 tgactgaggaggtagtggagttttcgtctctgtttgggactgttttggtgtccgattgggtttgttggctgctggtccagcagagtggcaggg--attgt 298  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  | |||    
29373120 tgactgaggaggtagtggagttttcgtctctgtttgggactgttttggtgtccgattgggtttgttggctgctggtccagcagagtggcagggccactgt 29373219  T
299 tgatttttctgctatggtgagtctgtgtgctgcggctggcattgccttta 348  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||    
29373220 tgatttttctgctatggtgtgtctgtgtgctgcggctggcattgccttta 29373269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 278
Target Start/End: Original strand, 10642960 - 10643011
Alignment:
227 tctctgtttgggactgttttggtgtccgattgggtttgttggctgctggtcc 278  Q
    |||||||||||| ||||||||||||| ||||||  |||||||||||||||||    
10642960 tctctgtttgggtctgttttggtgtctgattggtgttgttggctgctggtcc 10643011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 278
Target Start/End: Complemental strand, 32712878 - 32712827
Alignment:
227 tctctgtttgggactgttttggtgtccgattgggtttgttggctgctggtcc 278  Q
    |||||||||||| |||||||||||| |||||||  |||||||||||||||||    
32712878 tctctgtttgggtctgttttggtgttcgattggtgttgttggctgctggtcc 32712827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 242 - 283
Target Start/End: Complemental strand, 11682133 - 11682092
Alignment:
242 gttttggtgtccgattgggtttgttggctgctggtccagcag 283  Q
    ||||||||||||||||||  ||||||||||||||| ||||||    
11682133 gttttggtgtccgattggtattgttggctgctggttcagcag 11682092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0586 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0586
Description:

Target: scaffold0586; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 278
Target Start/End: Original strand, 3534 - 3585
Alignment:
227 tctctgtttgggactgttttggtgtccgattgggtttgttggctgctggtcc 278  Q
    |||||||||||| ||||||||||||||||||||  |||||||||||||||||    
3534 tctctgtttgggtctgttttggtgtccgattggtgttgttggctgctggtcc 3585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 278
Target Start/End: Complemental strand, 23923689 - 23923638
Alignment:
227 tctctgtttgggactgttttggtgtccgattgggtttgttggctgctggtcc 278  Q
    |||||||||||| ||||||||||||||||||||  |||||||||||||||||    
23923689 tctctgtttgggtctgttttggtgtccgattggcgttgttggctgctggtcc 23923638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 242 - 283
Target Start/End: Complemental strand, 23923561 - 23923520
Alignment:
242 gttttggtgtccgattgggtttgttggctgctggtccagcag 283  Q
    |||||||||||| |||||  ||||||||||||||||||||||    
23923561 gttttggtgtccaattggtgttgttggctgctggtccagcag 23923520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 141 - 202
Target Start/End: Original strand, 17257070 - 17257131
Alignment:
141 ttgagtagattgaagattgtttatggcctcttttattagtggtgttggaacccgagggagtg 202  Q
    |||||||| |||||||||| || | ||||||||||  |||||||||||||||| ||||||||    
17257070 ttgagtaggttgaagattgcttcttgcctcttttacgagtggtgttggaacccaagggagtg 17257131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 134 - 202
Target Start/End: Complemental strand, 43441405 - 43441337
Alignment:
134 ttggactttgagtagattgaagattgtttatggcctcttttattagtggtgttggaacccgagggagtg 202  Q
    |||| ||||||||||||||| ||| |||| | || |||||||  ||||||||||||| ||||| |||||    
43441405 ttggtctttgagtagattgaggatagtttcttgcttcttttacgagtggtgttggaatccgagagagtg 43441337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University