View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18537_low_35 (Length: 277)
Name: NF18537_low_35
Description: NF18537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18537_low_35 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 37 - 277
Target Start/End: Original strand, 43069243 - 43069481
Alignment:
| Q |
37 |
cttcaagaggagcttgtataataactagaagagggagtttccttggagggtctagatcttcctttgccgtacnnnnnnncttttgaaattcaatcttgta |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43069243 |
cttcaagaggagcttgtataataactagaagagggagtttccttggagggtctagatcttcctttgccgtacaaaaaaacttttgaaattcaatcttgta |
43069342 |
T |
|
| Q |
137 |
agagctttttgtttcatttcatgcacaaaa-tattgaggaaaattttgaatcgctcatattttttgatgaaatgaaatcttcttaattattatattactt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43069343 |
agagctttttgtttcatttcatgcacaaaaatattgaggaaaattttgaatcgctcatattttttgatgaaatgaaatcttcttaattattatattactt |
43069442 |
T |
|
| Q |
236 |
attctacacgtagatgattgatcacgatgagtgtctcctcac |
277 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43069443 |
attctacacgtagatgattgatc---atgagtgtctcctcac |
43069481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University