View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18537_low_37 (Length: 270)
Name: NF18537_low_37
Description: NF18537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18537_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 17 - 263
Target Start/End: Complemental strand, 49029824 - 49029578
Alignment:
| Q |
17 |
agaattaattatcgaaaaacaaaaagataagataaaggtctagatagaagtgtaccttttttgtggtgggtggtgttgtaggagtaaggatagtttgggc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49029824 |
agaattaattatcgaaaaacaaaaagataagataaaggtctagatagaagtgtaccttttttgtggtgggtggtgttgtaggagtaaggatagtttgggc |
49029725 |
T |
 |
| Q |
117 |
acgaattaaaggctgatatgtacttgttcttctagctttccatgttgatgtaagtcgtaacttcaactccttccattgcacctttgtacttcttctccca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49029724 |
acgaattaaaggctgatatgtacttgttcttccagctttccatgttgatgtaagtcgtaacttcaactccttccactgcacctttgtacttcttctccca |
49029625 |
T |
 |
| Q |
217 |
ataacatcattcttgttcccttttaatagtctattatctgatgatgt |
263 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49029624 |
ataacatcattcttgttccctttgaatagtctattatctgatgatgt |
49029578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University