View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18537_low_44 (Length: 237)

Name: NF18537_low_44
Description: NF18537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18537_low_44
NF18537_low_44
[»] chr1 (2 HSPs)
chr1 (116-228)||(40292009-40292121)
chr1 (1-34)||(40291876-40291909)


Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 116 - 228
Target Start/End: Original strand, 40292009 - 40292121
Alignment:
116 ggctcaaggagggacagaaattgaatttaagaaagtaacaacaaaaattgcattagagaaacagaaacaaactacacaccaggtaccatggaacctcttt 215  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40292009 ggctcaaggagggacagaaattgaatttaagaaaataacaacaaaaattgcattagagaaacagaaacaaactacacaccaggtaccatggaacctcttt 40292108  T
216 tggaattgatgat 228  Q
    |||||||||||||    
40292109 tggaattgatgat 40292121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 40291876 - 40291909
Alignment:
1 gcaccacatgcacacgatcagtcccgtcatcctt 34  Q
    ||||||||||||||||||||||||||||||||||    
40291876 gcaccacatgcacacgatcagtcccgtcatcctt 40291909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University