View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18537_low_45 (Length: 236)
Name: NF18537_low_45
Description: NF18537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18537_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 49350722 - 49350823
Alignment:
| Q |
1 |
ctgatctttgctcaaagattttctcctttacattatgtgtaccacatgtgtttttaagttaaaagtcaattttcgccaccgcataaccgaagttactgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49350722 |
ctgatctttgctcaaagattttctcctttacattatgtgtaccacatgtgtttttaagttaaaagtcaattttcgccaccgcataaccgaagttactgta |
49350821 |
T |
|
| Q |
101 |
tg |
102 |
Q |
| |
|
|| |
|
|
| T |
49350822 |
tg |
49350823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 167 - 221
Target Start/End: Original strand, 49350862 - 49350916
Alignment:
| Q |
167 |
taaaattgattcaactaaaagcataaagcaagatgtaattgattctgaaatatat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49350862 |
taaaattgattcaactaaaagcataaagcaagatgtaattgattctgaaatatat |
49350916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 89 - 131
Target Start/End: Original strand, 49350827 - 49350869
Alignment:
| Q |
89 |
gaagttactgtatgctcaaagatttcatgcctttttaaaattg |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49350827 |
gaagttactgtatgctcaaagatttcatgcctttttaaaattg |
49350869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University