View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18538_high_8 (Length: 220)
Name: NF18538_high_8
Description: NF18538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18538_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 21 - 205
Target Start/End: Original strand, 45280775 - 45280957
Alignment:
| Q |
21 |
tgtggtatactacatcttttggatctagggcgattgttaggtaacctttaatgatttaatgtgatgtacttatggttagttgtataacttgccttaaatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45280775 |
tgtggtatactacatcttttggatctagggcgattgttaggtaacctttaatgatttaatgtgatgtacttatggttagttgtataacttgccttaaatt |
45280874 |
T |
 |
| Q |
121 |
taaagcaatatatatggttaaaaactattgaaaaaatggtgatgtttcaaattcaatcactacgtaatgcgagatctgatctgtg |
205 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45280875 |
taaagca--atatatggttaaaaactattgaaaaaatggtgatgtttcaaattcaatcactacgtaatgcgagatctgatctgtg |
45280957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University