View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18538_low_10 (Length: 206)
Name: NF18538_low_10
Description: NF18538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18538_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 19 - 192
Target Start/End: Complemental strand, 44187712 - 44187539
Alignment:
| Q |
19 |
attaaaggatgtaaaggacatgtctttccatgtatcaattttgggtgaggttggtgttaaggaatcctgggttagactcttcaatgttgatccttttccc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44187712 |
attaaaggatgtaaaggacatgtctttccatgtatcaattttgggtgagcttggtgttaaggaatcctgggttagactcttcaatgttgatccttttccc |
44187613 |
T |
 |
| Q |
119 |
attcaacattctactgaacctgttttggcttgcattccaaatcctatcggagcttggaaagagggcaatatatt |
192 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44187612 |
attcaacattctactgaaccttttttggcttgcattccaaatcctaccggagcttggaaagagggcaatatatt |
44187539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 100
Target Start/End: Original strand, 24466321 - 24466390
Alignment:
| Q |
31 |
aaaggacatgtctttccatgtatcaattttgggtgaggttggtgttaaggaatcctgggttagactcttc |
100 |
Q |
| |
|
||||| ||| |||||||| |||||||||||||||| |||||||||||||||| ||| ||||||||||| |
|
|
| T |
24466321 |
aaaggccatatctttccaaatatcaattttgggtgaatttggtgttaaggaatcttggattagactcttc |
24466390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 51 - 100
Target Start/End: Complemental strand, 27230348 - 27230299
Alignment:
| Q |
51 |
tatcaattttgggtgaggttggtgttaaggaatcctgggttagactcttc |
100 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| ||| |||||||||| |
|
|
| T |
27230348 |
tatcaattttgggtgagattggtgtcaaggaatcatggactagactcttc |
27230299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 42 - 108
Target Start/End: Original strand, 31789524 - 31789590
Alignment:
| Q |
42 |
ctttccatgtatcaattttgggtgaggttggtgttaaggaatcctgggttagactcttcaatgttga |
108 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| |||||||| ||| | | |||||||| |||||| |
|
|
| T |
31789524 |
ctttccatatatcaattttgggtgaagttggtgtgaaggaatcatggatcaaactcttcactgttga |
31789590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 51 - 108
Target Start/End: Original strand, 9764511 - 9764568
Alignment:
| Q |
51 |
tatcaattttgggtgaggttggtgttaaggaatcctgggttagactcttcaatgttga |
108 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||| ||| ||||||||||| ||||||| |
|
|
| T |
9764511 |
tatcaattttgggtgaacttggtgtcaaggaatcatggattagactcttctatgttga |
9764568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 28867176 - 28867124
Alignment:
| Q |
51 |
tatcaattttgggtgaggttggtgttaaggaatcctgggttagactcttcaat |
103 |
Q |
| |
|
||||||| |||||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
28867176 |
tatcaatcttgggtgaaattggtgttgaggaatcatgggttagactcttcaat |
28867124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 51 - 108
Target Start/End: Original strand, 5162463 - 5162520
Alignment:
| Q |
51 |
tatcaattttgggtgaggttggtgttaaggaatcctgggttagactcttcaatgttga |
108 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||| ||| | | |||||||| |||||| |
|
|
| T |
5162463 |
tatcaattttgggtgaagttggtgtgaaggaatcatggatcaaactcttcactgttga |
5162520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 107
Target Start/End: Original strand, 13281091 - 13281147
Alignment:
| Q |
51 |
tatcaattttgggtgaggttggtgttaaggaatcctgggttagactcttcaatgttg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||| ||| |||||||||| |||||| |
|
|
| T |
13281091 |
tatcaattttgggtgaaattggtgttaaagaatcatggactagactcttcgatgttg |
13281147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University