View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18538_low_5 (Length: 307)
Name: NF18538_low_5
Description: NF18538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18538_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 17 - 295
Target Start/End: Original strand, 8441021 - 8441298
Alignment:
| Q |
17 |
atgaatgtggtaatattttaggaacnnnnnnngcacagtgtattgttttttagtggcaaatctattaagaaaagaaaacaagaataatttcaactctcga |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8441021 |
atgaatgtggtaatattttaggaacaaaaaaagcacagtgtattgttttttagtggcaaatctattaagaaaagaaaacaagaataatttcaactctcga |
8441120 |
T |
 |
| Q |
117 |
tgatgtatcgtgtacgtatagatcaccaatcgcttacatttagggatctcaatattccattggtggagttaagcaattatactagtgagcacgaaataac |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8441121 |
tgatgtatcgtgtacgtatagatctccaatcgcttacatt-agggatctcaatattccattggtggagttgagcaattatactagtgagcacgaaataac |
8441219 |
T |
 |
| Q |
217 |
tagaccgtgtcacaagcttcacgtatttataaaatctgcacattcatgatcgttggatcgagatagtacggttcatatc |
295 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
8441220 |
tagaccatgtcacaagcttcacgtatttataaaatccgcacatttatgatcgttggatcgagatagtacgattcatatc |
8441298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University