View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18539_low_1 (Length: 280)

Name: NF18539_low_1
Description: NF18539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18539_low_1
NF18539_low_1
[»] chr2 (1 HSPs)
chr2 (14-261)||(8871068-8871315)


Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 14 - 261
Target Start/End: Original strand, 8871068 - 8871315
Alignment:
14 aaatacggaaaaagcttcgcgatctcatctacatgcaaacatcaagttagaaaaacagatcaagtacagatcgaagtgaatgaaatgaacggcgaagatt 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
8871068 aaatacggaaaaagcttcgcgatctcatctacatgcaaacatcaagttagaaaaccagatcaagtacagatcgaagtgaatgaaatgaacggcgaagatt 8871167  T
114 tacctggatttccagcggcggaggatttaggaccatcgacaatggcaaacggtgcttggagaacggagggaagacggagtttgtgatcgacacggctgtt 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
8871168 tacctggatttccagcggcggaggatttaggaccatcgacaatggcgaacggtgcttggagaacggagggaagacggagtttgtgatcgacacggctgtt 8871267  T
214 ttggacttcgctgtagacggaggcgaagcgtgttgtgacggtgggagt 261  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
8871268 ttggacttcgctgtagacggaggcgaagcgtgttgtgacggtgggagt 8871315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University