View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18539_low_1 (Length: 280)
Name: NF18539_low_1
Description: NF18539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18539_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 14 - 261
Target Start/End: Original strand, 8871068 - 8871315
Alignment:
| Q |
14 |
aaatacggaaaaagcttcgcgatctcatctacatgcaaacatcaagttagaaaaacagatcaagtacagatcgaagtgaatgaaatgaacggcgaagatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8871068 |
aaatacggaaaaagcttcgcgatctcatctacatgcaaacatcaagttagaaaaccagatcaagtacagatcgaagtgaatgaaatgaacggcgaagatt |
8871167 |
T |
 |
| Q |
114 |
tacctggatttccagcggcggaggatttaggaccatcgacaatggcaaacggtgcttggagaacggagggaagacggagtttgtgatcgacacggctgtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8871168 |
tacctggatttccagcggcggaggatttaggaccatcgacaatggcgaacggtgcttggagaacggagggaagacggagtttgtgatcgacacggctgtt |
8871267 |
T |
 |
| Q |
214 |
ttggacttcgctgtagacggaggcgaagcgtgttgtgacggtgggagt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8871268 |
ttggacttcgctgtagacggaggcgaagcgtgttgtgacggtgggagt |
8871315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University