View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1853_high_12 (Length: 232)
Name: NF1853_high_12
Description: NF1853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1853_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 20 - 218
Target Start/End: Complemental strand, 45635256 - 45635062
Alignment:
| Q |
20 |
aaaagcaaactcgtattacaatctcatggtttccttagtagtctgttttgtttcccttcattgatcccctcgctatctcatcgatcaaatggcattctct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45635256 |
aaaagcaaactcgtattacaatctcatggtttccttagtagtctgttttgtttcccttcattgatcccctcgctatctcatc----aaatggcattctct |
45635161 |
T |
 |
| Q |
120 |
aatattgctatggttttgtgcttctttttagcaatcataatggcactgccaacccttgcaaccttctacactgtgggagattctttgggctggcaaatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45635160 |
aatattgctatggttttgtgcttctttttagcaatcaacatggcactgccaacccttgcaaccttctacactgtgggagattctttgggctggcaaatc |
45635062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University