View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1853_low_20 (Length: 217)
Name: NF1853_low_20
Description: NF1853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1853_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 14515271 - 14515099
Alignment:
| Q |
16 |
aatatatcaaatgtaatgtaatcttgtagttatggaaccgtaactacttttttgcatgcatgcttgtaacactgtgcaagagagaaatattatactgttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14515271 |
aatatatcaaatgtaatgtaatcttgtagttatggaaccttaactacttttttgcatgcatgcttgtaacactgtgcaagagagaaatattatactgttt |
14515172 |
T |
|
| Q |
116 |
aactttatgaaattggaattatgtaaaattattttaggaacactacatggattaatctaattgcatactttta |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14515171 |
aactttatgaaattggaattatgtaaaattattttaggaacactacatggattaatctaattgcatagtttta |
14515099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 106 - 188
Target Start/End: Original strand, 4597717 - 4597801
Alignment:
| Q |
106 |
tatactgtttaactttatgaaattggaattatgtaaaattattttaggaacac--tacatggattaatctaattgcatactttta |
188 |
Q |
| |
|
||||| ||||||| || |||||||||||||||||||| |||||||||| |||| || ||||||||||||||||||||| ||||| |
|
|
| T |
4597717 |
tatacagtttaacattgtgaaattggaattatgtaaagttattttagggacactatatatggattaatctaattgcatagtttta |
4597801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Original strand, 4597311 - 4597357
Alignment:
| Q |
22 |
tcaaatgtaatgtaatcttgtagttatggaaccgtaactactttttt |
68 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
4597311 |
tcaaatgtattgtaaacttgtagttatggaaccttaactactctttt |
4597357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University