View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18540_high_7 (Length: 276)
Name: NF18540_high_7
Description: NF18540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18540_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 258
Target Start/End: Complemental strand, 27771493 - 27771243
Alignment:
| Q |
8 |
aacaaatagttatggaagaagcaatgattcatcatagtagagttgattcaaaggcgccttcattgcgcgcttttagtgatttgtgtaatttgcaaggaag |
107 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27771493 |
aacaaatagttgtggaagaagcaatgatgcaacatagtagagttgagtcgaaggcgccatcattgcgcgcttttagtgatttgtgtaatttgcaaggaag |
27771394 |
T |
 |
| Q |
108 |
agaaagaataatcgaaattagagacgaagtttgtgaatcgatcggaaggtcagtgtctatggatcattcatttcaaaatggtttttcaattggtgatgtg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27771393 |
agaaagaataatcgaaattagagacgaagtttgtgaatcgatcggaaggtcagtgtctatggatcattcatttcaaaatggtttttcaattggtgatgtg |
27771294 |
T |
 |
| Q |
208 |
ttgaatatgaatgaagatgaagatgattcttgtgaagaaggatgttcaatg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27771293 |
ttgaatatgaatgaagatgaagatgattcttgtgaagaaggatgttcaatg |
27771243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University