View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18540_low_11 (Length: 266)
Name: NF18540_low_11
Description: NF18540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18540_low_11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 266
Target Start/End: Complemental strand, 24691038 - 24690789
Alignment:
| Q |
17 |
acgtatttccttctaaaaagataaaactaaatattcgagatgggactctttatgaatggctatattgacagcaaacagggtcnnnnnnnggctgtttctc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24691038 |
acgtatttccttctaaaaagataaaactaaatattcgagatgggactctttatgaatggctatattgacagcaaacagggtctttttttggctgtttctc |
24690939 |
T |
|
| Q |
117 |
cttctaaagcttcacatattttaattaggaccttttattctcacacaataaatcaaacaggattattgaatttctgaattgaattagttttgaatgtcaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24690938 |
cttctaaagcttcacatattttaattaggaccttttattctcacacaataaatcaaacaggattattgaatttctgaattgaattagttttgaatgtcaa |
24690839 |
T |
|
| Q |
217 |
gttgatattttatatccattatacaatcactctcaacattgaccatccct |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24690838 |
gttgatattttatatccattatacaatcactctcaacattgaccatccct |
24690789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University