View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18540_low_15 (Length: 240)
Name: NF18540_low_15
Description: NF18540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18540_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 4392498 - 4392282
Alignment:
| Q |
1 |
gaaaagaatacatgctggggacttaattaggaatcttgttggtgcagagatggcagagnnnnnnnnggtgttaatgctagggctttcatcacttagaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4392498 |
gaaaagaatacatgctggggacttaattaggaatcttgttggtgcagagatggcagagaaaaaaaaggtgttaatgctagggctttcatcacttagaaag |
4392399 |
T |
|
| Q |
101 |
aaagnnnnnnnnnnnggtgtggagtgtttgtgatctgaacaatttgtctctttcttttaacacatttccatgggggaagggaaagagaaaaagaaagagt |
200 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4392398 |
aaa------aaaaaaggtgtggagtgtgtgtgatctgaacaatttgtctctttcttttaacacatttccatgggggaagggaaagagaaaaagaaagagt |
4392305 |
T |
|
| Q |
201 |
agtgagttgtgtgttattgatga |
223 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
4392304 |
agtgagttgtgtgttattaatga |
4392282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University