View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18541_high_14 (Length: 229)
Name: NF18541_high_14
Description: NF18541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18541_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 23 - 211
Target Start/End: Complemental strand, 46121953 - 46121762
Alignment:
| Q |
23 |
agggggcggcagcccaaagcaccataattttagatatatt---agaaagagtatttaattaacaacttgtgagaatttaaatatttgataagctaaaaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46121953 |
agggggcggcagcccaaagcaccataattttagatatattcatagaaagagtatttaattaacaacctgtgagaatttaaatatttgataagctaaaaca |
46121854 |
T |
 |
| Q |
120 |
ttttattttagcaggtgtcttannnnnnnccgggaccttaatttttgtaaaaataaaaacgtttcattcaaagtggatataattacgggtac |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46121853 |
ttttattttagcaggtgtcttatttttttgcgggaccttaatttttgtaaaaataaaaacgtttcattcaaagtggatataattacgggtac |
46121762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University