View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18541_low_17 (Length: 214)
Name: NF18541_low_17
Description: NF18541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18541_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 11742335 - 11742156
Alignment:
| Q |
17 |
atatcccactattcagtttaaaaaatgtgaatttttagttattaggctacttgacnnnnnnnnngtgcaacttaaataataaaagattgtagaaacattt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11742335 |
atatcccactattcagtttaaaaaatgtgaatttttaattattaggctacttgacaaaaaaaa-gtgcaacttaaataataaaagattgcagaaacattt |
11742237 |
T |
 |
| Q |
117 |
aatatgttgagacacgagattgaatttctctactagttttcttttttaataacaatgggtgtttgtttccagactaagaat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11742236 |
aatatgttgagacacgagattgaatttctctactagttttcttttttaataacaatgggtgattgtttccagactaagaat |
11742156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University