View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18541_low_5 (Length: 368)

Name: NF18541_low_5
Description: NF18541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18541_low_5
NF18541_low_5
[»] chr3 (5 HSPs)
chr3 (90-351)||(38792128-38792391)
chr3 (187-246)||(407932-407991)
chr3 (187-246)||(415951-416010)
chr3 (196-234)||(6457721-6457759)
chr3 (196-246)||(49962756-49962806)
[»] chr6 (1 HSPs)
chr6 (187-246)||(24184414-24184473)
[»] chr1 (2 HSPs)
chr1 (187-246)||(24357806-24357865)
chr1 (187-246)||(24345535-24345592)


Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 90 - 351
Target Start/End: Original strand, 38792128 - 38792391
Alignment:
90 gccaatcatcaccggaacaaccaatcatgcagaccctcatgtcgtgactgcagaaaatcagacaacagttcaaactaaaaacatcgtaacgacaatgtaa 189  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
38792128 gccaatcatcaccggaacaaccaatcatgcagactctcatgtcgtgactgcagaaaaccagacaacagttcaaactaaaaacatcgtaacgacaatgtaa 38792227  T
190 tcttggcttttgatgtctggatcattcaac--ttgtgtctctatgatgattatgttgattttcatatcctacaaagagagacaaagaggttgtattcccg 287  Q
    ||||||||||||||| ||||||||||||||  ||    | | ||||||||| ||||||||||||||||||||||||||||  ||||||||||||||||||    
38792228 tcttggcttttgatggctggatcattcaacagttcaaac-caatgatgattgtgttgattttcatatcctacaaagagaggtaaagaggttgtattcccg 38792326  T
288 catagtaaaaaa-caacatgttgtatttccatcaataagaaaacttcaaaccaacacctgtaata 351  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
38792327 catagtaaaaaaccaacatgttgtatttccatcaataagaaaacttcaaaccaacacctgtaata 38792391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 187 - 246
Target Start/End: Original strand, 407932 - 407991
Alignment:
187 taatcttggcttttgatgtctggatcattcaacttgtgtctctatgatgattatgttgat 246  Q
    |||||||||||||||||| |||||||||||||||| ||||||| |||||||| |||||||    
407932 taatcttggcttttgatggctggatcattcaacttatgtctctgtgatgattgtgttgat 407991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 187 - 246
Target Start/End: Complemental strand, 416010 - 415951
Alignment:
187 taatcttggcttttgatgtctggatcattcaacttgtgtctctatgatgattatgttgat 246  Q
    |||||||||||||||||| |||||||||||||||| ||||||| |||||||| |||||||    
416010 taatcttggcttttgatggctggatcattcaacttatgtctctgtgatgattgtgttgat 415951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 196 - 234
Target Start/End: Original strand, 6457721 - 6457759
Alignment:
196 cttttgatgtctggatcattcaacttgtgtctctatgat 234  Q
    ||||||||| ||||||||||||||||| |||||||||||    
6457721 cttttgatggctggatcattcaacttgcgtctctatgat 6457759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 196 - 246
Target Start/End: Complemental strand, 49962806 - 49962756
Alignment:
196 cttttgatgtctggatcattcaacttgtgtctctatgatgattatgttgat 246  Q
    ||||||||| ||||||||||||||||| ||||||| ||| ||| |||||||    
49962806 cttttgatggctggatcattcaacttgcgtctctaagattattgtgttgat 49962756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 187 - 246
Target Start/End: Original strand, 24184414 - 24184473
Alignment:
187 taatcttggcttttgatgtctggatcattcaacttgtgtctctatgatgattatgttgat 246  Q
    |||||||||||||||||| |||||||||||||||| ||||||| |||||||| |||||||    
24184414 taatcttggcttttgatggctggatcattcaacttatgtctctgtgatgattgtgttgat 24184473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 187 - 246
Target Start/End: Complemental strand, 24357865 - 24357806
Alignment:
187 taatcttggcttttgatgtctggatcattcaacttgtgtctctatgatgattatgttgat 246  Q
    |||||||||||||||||| |||||||||||||||| ||||||| |||||||| |||||||    
24357865 taatcttggcttttgatggctggatcattcaacttatgtctctgtgatgattgtgttgat 24357806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 187 - 246
Target Start/End: Complemental strand, 24345592 - 24345535
Alignment:
187 taatcttggcttttgatgtctggatcattcaacttgtgtctctatgatgattatgttgat 246  Q
    |||||||||||||||||| |||||||||||||||| ||||||  |||||||| |||||||    
24345592 taatcttggcttttgatggctggatcattcaacttatgtctc--tgatgattgtgttgat 24345535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University