View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18542_high_6 (Length: 294)
Name: NF18542_high_6
Description: NF18542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18542_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 73 - 282
Target Start/End: Original strand, 51720390 - 51720599
Alignment:
| Q |
73 |
atatgttgaattcattggcaaatgggcaggtgagtaaaggttcaaagccaccggctttcactttgaaagaccaagatggcaagacagtgagtctctccaa |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51720390 |
atatgttgaattcattggcaaatgggcaggtgagtaaaggttcaaagccaccggctttcactttgaaagaccaagatggcaagacagtgagtctctccaa |
51720489 |
T |
 |
| Q |
173 |
gtacaaagggaaacctgtggttgtttatttctaccctgctgatgagacccctggctgtaccaaacaggtaagaagaaagaaacactcatttactctcaat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51720490 |
gtacaaagggaaacctgtggttgtttatttctaccctgctgatgagacccctggctgtaccaaacaggtaagaagaaagaaacactcatttactctcaat |
51720589 |
T |
 |
| Q |
273 |
gctgcatatt |
282 |
Q |
| |
|
|||||||||| |
|
|
| T |
51720590 |
gctgcatatt |
51720599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 51720326 - 51720373
Alignment:
| Q |
1 |
aggtactttattcacaatatacaagttgctacaatatatcagcattac |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51720326 |
aggtactttattcacaatatacaagttgctacaatatatcagcattac |
51720373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University