View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18542_low_13 (Length: 235)
Name: NF18542_low_13
Description: NF18542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18542_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 31028768 - 31028952
Alignment:
| Q |
1 |
ttttatattgcgtaaaaaatgtgatcatatacttttgaattttgatattctcacaattgtggtggaatacaaccttgatattgtgcatagtcgctatttg |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31028768 |
ttttatattgcg-aaaaaatgtgatcatatactcttga-------tattctcacaattgtggtggaatacaaccttgatattgtgcatagtcgctatttg |
31028859 |
T |
 |
| Q |
101 |
tagaccttttgatgagaatgtggatcaaatggagaatggctgaataannnnnnnngttgttgtgaagaaaacgtataaatgctgcttgatagctctcgg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31028860 |
tagaccttttgatgagaatgtggatcaaatggagaatggctgaata------tttttttttgtgaagaaaacgtataaatgccgcttgatagctctcgg |
31028952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University