View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18542_low_17 (Length: 219)
Name: NF18542_low_17
Description: NF18542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18542_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 39675010 - 39674824
Alignment:
| Q |
18 |
atttgcaatataaaacctacatatatagcagtaatattcttgctccacatatttatctttgtgaatgagaaatactcttacttccacattacaactgcct |
117 |
Q |
| |
|
||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39675010 |
atttgcaatataaaaccta----tattgtagtaatattcttgctccacatatttatctttctgaatgagaaatactcttacttccacattacaactgcct |
39674915 |
T |
|
| Q |
118 |
caaaggattcaaa----nnnnnnnnaaaataaaaaggtctgaatcacatgtcgtattcgttaaacttggcaaatggctctcacatcctttg |
204 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39674914 |
caaaggattcaaaccccccccccccaaaataaaaaggtccgaatcacatgtcgtattcgttaaacttggcaaatggctctcacatcctttg |
39674824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University