View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18542_low_3 (Length: 466)
Name: NF18542_low_3
Description: NF18542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18542_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 420; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 420; E-Value: 0
Query Start/End: Original strand, 9 - 448
Target Start/End: Original strand, 29281262 - 29281701
Alignment:
| Q |
9 |
gattattcttcggttatgaatttaaggaaatgggcctggagacgggcttgggcctgaggacggagtttgggccaaagatgagagggtttgacaaaaacaa |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29281262 |
gatttttcttcggttatgaatttaaggaaatgggcctggagacgggcttgggcctgaggacggagtttaggccaaagatgagagggtttgacaaaaacaa |
29281361 |
T |
 |
| Q |
109 |
gagcgcgtgcagcgtttgtgcgagtggggatttctggggatgaggttagaaggaaaaagagtttgatcatgaggagatcagggtggtggtgtttgcaaca |
208 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29281362 |
gagcgcgtgcagcgtttgtgcgagtagggatttctggggatgaggttagaaggaaaaagagtttgatcatgaggagatcagggtggtggtgtttgcaaca |
29281461 |
T |
 |
| Q |
209 |
ttgaaggaatgtgagtgattttgatcggttttgttgttgttcatggttttggtgttgagtagggttagggtaaaggtgagagaagagagtttccatggct |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29281462 |
ttgaaggaatgtgagtgattttgatcggttttgttgttgttcatggttttggtgttgagtagggttagggtaaaggtgagagaagagagtttccatggct |
29281561 |
T |
 |
| Q |
309 |
ttgtcatcgttggaacttagaatcttgaaggtttcggattgtaattctaatgggaattcagattccattgtgagaatgtgatgagtgcaataggatttag |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29281562 |
ttgtcatcgttggaacttagaatcttgaaggtttcggattgtaattctaatgggaattcagattccattgtgagaatgtgatgagtgcaattggatttag |
29281661 |
T |
 |
| Q |
409 |
ggtttgttcttgatgatatgttgtttatcttggtgtaact |
448 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29281662 |
ggtttgttcttgatgatatgttgtttattttggtgtaact |
29281701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University