View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18543_low_9 (Length: 315)
Name: NF18543_low_9
Description: NF18543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18543_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 7e-80; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 7899358 - 7899156
Alignment:
| Q |
18 |
ccacagaagacacaaatacgtttgaacctactactaaatttgatgggtttttgttgcttacgaatttccatcattgggaaaagtatttttatgattttgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
7899358 |
ccacagaagacacaaatacgtttgaacctactactaaatttgatgggttgttgttgcttatgaatttccataatagggaaaagtatttttatgattttgt |
7899259 |
T |
|
| Q |
118 |
tgcttgaattggttatgttatgatatgtattgtgaatactgataaatataatgaagggtgagagagacatgagaatagaataggcaaacgtgtttcttgt |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7899258 |
tgcttgaattggttatgttatgata-----tgtgaat----ataaatataatgaagggtgagagagacagaagaatagaataggcaaacgtgtttcttgt |
7899168 |
T |
|
| Q |
218 |
gctaaccaaaag |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7899167 |
gctaaccaaaag |
7899156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 246 - 298
Target Start/End: Complemental strand, 7898772 - 7898720
Alignment:
| Q |
246 |
tgtttgttggaaaacaaatggccaaaagtgagtgaagggaatctatgagaatt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7898772 |
tgtttgttggaaaacaaatggccaaaagtgagtgaagggaatctataagaatt |
7898720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 7883787 - 7883740
Alignment:
| Q |
46 |
tactactaaatttgatgggtttttgttgcttacgaatttccatcattgg |
94 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
7883787 |
tactactaaatttgatgggtttt-gttgcttatgaatttccatcattgg |
7883740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University