View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18544_high_10 (Length: 324)
Name: NF18544_high_10
Description: NF18544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18544_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 44796834 - 44796754
Alignment:
| Q |
140 |
gtggaaattttcaatttcaattttgatagaatacaaataatacagggttttgatgcagatccagagtataaatcgatcacg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44796834 |
gtggaaattttcaatttcaattttgatagaatacaaataatacagggttttgatgcagatccagagtataaatcgatcacg |
44796754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 75 - 108
Target Start/End: Complemental strand, 44796899 - 44796866
Alignment:
| Q |
75 |
tcagagtaatctcacagtgaattatgtcggcaac |
108 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
44796899 |
tcagagtaatctcacagcgaattatgtcggcaac |
44796866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 174 - 206
Target Start/End: Complemental strand, 18654876 - 18654844
Alignment:
| Q |
174 |
aaataatacagggttttgatgcagatccagagt |
206 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
18654876 |
aaataatactgggttttgatgcagatccagagt |
18654844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University