View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18544_low_12 (Length: 324)

Name: NF18544_low_12
Description: NF18544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18544_low_12
NF18544_low_12
[»] chr4 (2 HSPs)
chr4 (140-220)||(44796754-44796834)
chr4 (75-108)||(44796866-44796899)
[»] chr5 (1 HSPs)
chr5 (174-206)||(18654844-18654876)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 44796834 - 44796754
Alignment:
140 gtggaaattttcaatttcaattttgatagaatacaaataatacagggttttgatgcagatccagagtataaatcgatcacg 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44796834 gtggaaattttcaatttcaattttgatagaatacaaataatacagggttttgatgcagatccagagtataaatcgatcacg 44796754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 75 - 108
Target Start/End: Complemental strand, 44796899 - 44796866
Alignment:
75 tcagagtaatctcacagtgaattatgtcggcaac 108  Q
    ||||||||||||||||| ||||||||||||||||    
44796899 tcagagtaatctcacagcgaattatgtcggcaac 44796866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 174 - 206
Target Start/End: Complemental strand, 18654876 - 18654844
Alignment:
174 aaataatacagggttttgatgcagatccagagt 206  Q
    ||||||||| |||||||||||||||||||||||    
18654876 aaataatactgggttttgatgcagatccagagt 18654844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University