View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18544_low_4 (Length: 568)
Name: NF18544_low_4
Description: NF18544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18544_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 531; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 531; E-Value: 0
Query Start/End: Original strand, 10 - 555
Target Start/End: Complemental strand, 47735717 - 47735171
Alignment:
| Q |
10 |
caatgttctgtctcctctctagcagcatttgtcacctattttcatgtcactcccatgacttaaacctgtttctgttaagaatagattatgtcggaatcgc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735717 |
caatgttctgtctcctctctagcagcatttgtcacctattttcatgtcactcccatgacttaaacctgtttctgttaagaatagattatgtcggaatcgc |
47735618 |
T |
|
| Q |
110 |
tgtcatgatcataacctcattcttccctcaaatttactatgttttcctatgtcaacctcattggcaactcatctacctagccggtattacagctatggga |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47735617 |
tgtcatgatcataacctcattcttccctcaaatttactatgttttcctatgtcaacctcattggcaactcatctacctagccggtattacagccatggga |
47735518 |
T |
|
| Q |
210 |
ctattcaccatagtaacattgctttccccatcactttctaccggtaaacaccgcgcttttcgagctatgctgttctgttcaatgggacttttcggcatt- |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735517 |
ctattcaccatagtaacattgctttccccatcactttctaccggtaaacaccgcgcttttcgagctatgctgttctgttcaatgggacttttcggcattg |
47735418 |
T |
|
| Q |
309 |
tgcctgcagttcatgcttgtgttgcgaattggggaaatcctcggcgcaatgttacactagcatatgaatgtgtcatggcattgtcttacttgatagggac |
408 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735417 |
tacctgcagttcatgcttgtgttgcgaattggggaaatcctcggcgcaatgttacactagcatatgaatgtgtcatggcattgtcttacttgatagggac |
47735318 |
T |
|
| Q |
409 |
tttgttctatgtgacgcggataccggaaagatggaggcctggttggtttgatttagcaggacatagtcatcaaatatttcatattttggttgtggttggt |
508 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735317 |
tttgttctatgtgacgcggataccggaaagatggaggcctggttggtttgatttagcaggacatagtcatcaaatatttcatattttggttgtggttggt |
47735218 |
T |
|
| Q |
509 |
gcattatcacattatgcagctactcttaaaatgcttgaatggcgtga |
555 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735217 |
gcattatcacattatgcagctactcttaaaatgcttgaatggcgtga |
47735171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University