View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18545_high_12 (Length: 219)
Name: NF18545_high_12
Description: NF18545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18545_high_12 |
 |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0128 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 28 - 201
Target Start/End: Complemental strand, 31913 - 31740
Alignment:
| Q |
28 |
ctctcacaatgcatgaacaacctgtaattgctttgagagtgcttgaatagggttcctcttcaaatacatcataagagactgcgagtttcatgtgatatgt |
127 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31913 |
ctctcaaaatgcatgaacaacctgtaattgctttgagagtgcttgaataggattcctcttcaaatacatcataagagactgcgagtttcatgtgatgtgt |
31814 |
T |
 |
| Q |
128 |
ttacgcaccataaacaatcattatcaatctacaccctaactgcactgaatatagcccttttcgatcatcaatcc |
201 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31813 |
ttacacgccataaacaatcattatcaatctacaccctaactgcactgaatatagcccttttcgatcatcaatcc |
31740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University