View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18545_low_5 (Length: 378)
Name: NF18545_low_5
Description: NF18545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18545_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 20 - 359
Target Start/End: Complemental strand, 43017229 - 43016894
Alignment:
| Q |
20 |
tcaaggtgataaggtcaatgttgttttggtagacctccccaatcatatatttaatcatcggaagtattaattagtccatgttttgtttcacatttagagg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43017229 |
tcaaggtgataaggtcaatgttgttttggtagacctccccaatcatatatttaatcatcggaagtatta----gtccatgttttgtttcacatttagagg |
43017134 |
T |
|
| Q |
120 |
agatgaactcgattatgcaggtgtagaattaattgtttcaacatgttagtgtctttgttgtgtccgttgtctgtgttcgtgcttgatatatagatgcttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43017133 |
agatgaactcgattatgcaggtgtagaattaattgtttcaacatgttagtgtctttgttgtgtccgttgtctgtgttcgtgcttgatatatagatgcttg |
43017034 |
T |
|
| Q |
220 |
ttactatcacgtaatatcccatcaagatcatcaaatgactatcttcttgcctacccctttctcttttcccttccgttttcttttcttccaccagcgaatg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43017033 |
ttactatcacgtaatatcccatcaagatcatcaaatgactatcttcttgcctacccctttctcttttcccttccgttttcttttcttccaccagcgaatg |
43016934 |
T |
|
| Q |
320 |
aaaacgatgtcaaaagctcacgactgtgtttgggggtttt |
359 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43016933 |
aaaacggtgtcaaaagctcacgactgtgtttgggggtttt |
43016894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University