View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18546_high_6 (Length: 275)
Name: NF18546_high_6
Description: NF18546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18546_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 41896745 - 41896998
Alignment:
| Q |
1 |
cataggttattattatttatgggatggatgttgttttgtttctttaatttggtgnnnnnnncgttattatcttgctaatatcacttttgattgaattttg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41896745 |
cataggttattattatttatgg-atggatgttgttttgtttctttaatttggtgtttttttcgttattatcgtgctaatatcacttttgattgaattttg |
41896843 |
T |
 |
| Q |
101 |
actttatttcttctataactactagtatcttattttgatccagaagattaatgtgnnnnnnnnnnnnnnnnnattttgaagctacctttctttttatttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
41896844 |
gctttatttcttctataactactagtatattattttgatccagaagattaatgtg---gctgctgcatctgcattttgaagctacctttcgttttatttt |
41896940 |
T |
 |
| Q |
201 |
aggttataattatcagtgttattccaagcttatatataacctagctataaaagtgata |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41896941 |
aggttataattatcagtgttattccaagcttatatataacctagctataaaagtgata |
41896998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University