View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18546_low_10 (Length: 251)
Name: NF18546_low_10
Description: NF18546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18546_low_10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 8 - 251
Target Start/End: Original strand, 2782279 - 2782522
Alignment:
| Q |
8 |
tgagatgaagaagaaatgtgagttgtgcaaaagtccagcaaagttgttctgtgaatcagatcaggcaagcctttgttgggaatgtgatgctaaggttcac |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782279 |
tgagatgaagaagaaatgtgagttgtgcaaaagtccagcaaagttgttctgtgaatcagatcaagcaagcctttgttgggaatgtgatgctaaggttcac |
2782378 |
T |
 |
| Q |
108 |
actgcaaacttcatagtcacaaagcatcacaggtttcttctctgccatatttgtcaatctttaacaccttggcatggcactggacccaagtttgtaccca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782379 |
actgcaaacttcatagtcacaaagcatcacaggtttcttctctgccatatttgtcaatctttaacaccttggcatggcactggacccaagtttgtaccca |
2782478 |
T |
 |
| Q |
208 |
ctatctccctttgtaaccactgtgttgctgttaccaacaacaat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782479 |
ctatctccctttgtaaccactgtgttgctgttaccaacaacaat |
2782522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University