View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18546_low_11 (Length: 245)
Name: NF18546_low_11
Description: NF18546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18546_low_11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 245
Target Start/End: Complemental strand, 2782793 - 2782568
Alignment:
| Q |
20 |
tacagcacataaactagaaactaattttgttacttaccaatctatgaatctaaaacaaaaatcctcaaattaatttagcacacaagaaaaatgaagagag |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782793 |
tacatcacataaactagaaactaattttgttacttaccaatctatgaatctaaaacaaaaatcctcaaattaatttagcacacaagaaaaatgaagagag |
2782694 |
T |
 |
| Q |
120 |
gaagaaaaattacaggatatatatttatactagttggtagcattagtttgcactatttgaagaacaagaagaaactggtggtggagttgtagatttccat |
219 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782693 |
gaagaaaaattacaggaaatatatttatactagttggtagcattagtttgcactatttgaagaacaagaagaaactggtggtggagttgtagatttccat |
2782594 |
T |
 |
| Q |
220 |
ggaaccacttgattttcttcatcatc |
245 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2782593 |
ggaaccacttgattttcttcatcatc |
2782568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University