View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18546_low_5 (Length: 349)
Name: NF18546_low_5
Description: NF18546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18546_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 9 - 331
Target Start/End: Complemental strand, 40925068 - 40924750
Alignment:
| Q |
9 |
ttatactgtttgcttccattgttgtggttgctattgcagtgatattgatcttggcatacagtccaactttcttaaaatggctgcgttcacctcccaaacc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925068 |
ttatactgtttgcttccattgttgtggttgctattgcagtgatattgatcttggcatacggtccaactttcttaaaatggctgcgttcacctcccaaacc |
40924969 |
T |
 |
| Q |
109 |
accacgggcagcggtggcacctttgcccctcactgagttgaacgtcgtgcaggcactaccgccggagcaagattgagtccaatgaagacacaatgcaggt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40924968 |
accacgggcagcggtggcacctttgcccctcactgagttga-cgtcgtgcaggcactaccgccggagcaagattgagtccaatgaagacacaatacaggt |
40924870 |
T |
 |
| Q |
209 |
aacaacaagtacatttctttgaggatgttcatcgcctttttgaaactcatccgttctggagaagaattctgagacaagctgggaaggaccaagaacaagg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40924869 |
aacaacaagtacatttctttgaggatgttcatcgcctttttgaaactcatccgttctggagaagaattctgagacaagctgggaaggaccaagaacaagg |
40924770 |
T |
 |
| Q |
309 |
catgttgtcgtcaatgggaaact |
331 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
40924769 |
ca---cgtcgtcaatgggaaact |
40924750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University