View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18547_high_6 (Length: 230)

Name: NF18547_high_6
Description: NF18547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18547_high_6
NF18547_high_6
[»] chr7 (1 HSPs)
chr7 (15-212)||(33578576-33578773)
[»] chr5 (1 HSPs)
chr5 (14-192)||(37917490-37917668)


Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 212
Target Start/End: Complemental strand, 33578773 - 33578576
Alignment:
15 atgaaaacagaaacataagcagaattatcttctgggtttttaccgtcggggtagaagtaaattgcccattggtaaccgccgacggtgaaagtctcgctgg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33578773 atgaaaacagaaacataagcagaattatcttctgggtttttaccgtcggggtagaagtaaattgcccattggtaaccgccgacggtgaaagtctcgctgg 33578674  T
115 ctatgtgtttaccaactcccattccttttgcaagtgagtagcctttgattacgaacttgtgtgaaccgtttaccgtttctgttacggaacgggaactt 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
33578673 ctatgtgtttaccaactcccattccttttgcaagtgagtagcctttgattacaaacttgtgtgaaccgtttaccgtttctgttacggaacgggaactt 33578576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 37917668 - 37917490
Alignment:
14 gatgaaaacagaaacataagcagaattatcttctgggtttttaccgtcggggtagaagtaaattgcccattggtaaccgccgacggtgaaagtctcgctg 113  Q
    ||||||||| |||||||| ||||||||||| || || || || || ||||| |||||||| || ||||| || || || ||||||||||||   |||||     
37917668 gatgaaaaccgaaacatacgcagaattatcctccggattcttcccatcgggatagaagtagatcgcccactgataccctccgacggtgaaaacatcgctt 37917569  T
114 gctatgtgtttaccaactcccattccttttgcaagtgagtagcctttgattacgaacttgtgtgaaccgtttaccgttt 192  Q
    || |||||||| ||||| |||||||| || ||||| ||||| |||| ||| | ||| ||||| |||||||| |||||||    
37917568 gcaatgtgttttccaacccccattcccttcgcaagcgagtacccttggatcaagaatttgtgcgaaccgttaaccgttt 37917490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University