View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18547_low_4 (Length: 301)
Name: NF18547_low_4
Description: NF18547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18547_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 8173820 - 8173537
Alignment:
| Q |
1 |
ttaattatattgtacttgtaaagagtaagataccccacttgcgatgatggtaattataggcattagtttctagtaatctcaaaagtgatggtttaagaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8173820 |
ttaattatattgtacttgtaaagagtaagataccccacttgcgatgatggtaagtataggcattagtttctagtaatctcaaaagtgatggtttaagaat |
8173721 |
T |
 |
| Q |
101 |
gattttaaggtggatatttatagtgtttttggtccccttttagttgtagcaatctaaggggttgtttaatgcgttcagtgagttaattccacgtataagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8173720 |
gattttaaggtggatatttatagtgtttttggtccccttttagttgtagcaatctaaggggttgtttaatgcgttcagtgagttaattccacatataagg |
8173621 |
T |
 |
| Q |
201 |
ggagtgtgttaatgatatctgacattacttaaacataatgttcgttatcagctctcattcgtccttacatgccttactctgtat |
284 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8173620 |
ggagtgtgttaatgatatctgacattatttaaacataatgttcgttatcagctctcattcgtccttacatgccttgttctgtat |
8173537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University