View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18547_low_6 (Length: 230)
Name: NF18547_low_6
Description: NF18547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18547_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 212
Target Start/End: Complemental strand, 33578773 - 33578576
Alignment:
| Q |
15 |
atgaaaacagaaacataagcagaattatcttctgggtttttaccgtcggggtagaagtaaattgcccattggtaaccgccgacggtgaaagtctcgctgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33578773 |
atgaaaacagaaacataagcagaattatcttctgggtttttaccgtcggggtagaagtaaattgcccattggtaaccgccgacggtgaaagtctcgctgg |
33578674 |
T |
|
| Q |
115 |
ctatgtgtttaccaactcccattccttttgcaagtgagtagcctttgattacgaacttgtgtgaaccgtttaccgtttctgttacggaacgggaactt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33578673 |
ctatgtgtttaccaactcccattccttttgcaagtgagtagcctttgattacaaacttgtgtgaaccgtttaccgtttctgttacggaacgggaactt |
33578576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 37917668 - 37917490
Alignment:
| Q |
14 |
gatgaaaacagaaacataagcagaattatcttctgggtttttaccgtcggggtagaagtaaattgcccattggtaaccgccgacggtgaaagtctcgctg |
113 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || || || || || ||||| |||||||| || ||||| || || || |||||||||||| ||||| |
|
|
| T |
37917668 |
gatgaaaaccgaaacatacgcagaattatcctccggattcttcccatcgggatagaagtagatcgcccactgataccctccgacggtgaaaacatcgctt |
37917569 |
T |
|
| Q |
114 |
gctatgtgtttaccaactcccattccttttgcaagtgagtagcctttgattacgaacttgtgtgaaccgtttaccgttt |
192 |
Q |
| |
|
|| |||||||| ||||| |||||||| || ||||| ||||| |||| ||| | ||| ||||| |||||||| ||||||| |
|
|
| T |
37917568 |
gcaatgtgttttccaacccccattcccttcgcaagcgagtacccttggatcaagaatttgtgcgaaccgttaaccgttt |
37917490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University