View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18548_low_3 (Length: 343)
Name: NF18548_low_3
Description: NF18548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18548_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 65 - 327
Target Start/End: Original strand, 34891373 - 34891635
Alignment:
| Q |
65 |
cctaaattcataatagaagtatcagaagcaaaatcattaacccaatcaacaaacctaaccctaacccaactcctccccaccattgtcaaatcatcccaac |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34891373 |
cctaaattcataatagaagtatcagaagcaaaatcattaacccaatcaacaaacctaaccctaacccaactcctccccaccattgtcaaatcatcccaac |
34891472 |
T |
|
| Q |
165 |
cattagcccgtgtccctatctccaaattccacgttgcggccgtcgcagttggaatctccggtcgaatcttcatcggtgtcaatgtcgaattccctaacct |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34891473 |
cattagcccgtgtccctatctccaaattccatgttgcggccgtcgcagttggaatctccggtcgaatcttcatcggtgtcaatgtcgaattccctaacct |
34891572 |
T |
|
| Q |
265 |
tccttttcaccataccatccatgcagaacaatttctcttaacaaacctctcccataacaaaga |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34891573 |
tccttttcaccataccatccatgcagaacaatttctcttaacaaacctctcccataacaaaga |
34891635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University