View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18548_low_6 (Length: 241)
Name: NF18548_low_6
Description: NF18548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18548_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 44977027 - 44976802
Alignment:
| Q |
1 |
tatgtatttacacataattaagtggatcctctgttt-ctcttctacgttcccattttcatccctaaataagtctcccataaacttatcatttattacaca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44977027 |
tatgtatttacacataattaagtggatcctctgttttctcttctacgttcccattttcatccctaaataagtctcccataaacttatcatttattacaca |
44976928 |
T |
 |
| Q |
100 |
agagaaatttggaaaagtcgtttagtgttagcaatgatcctggttctctataatggtctcacattgtctaatgttgttatatgtgtaaccatagtaagtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44976927 |
agagaaatttggaaaagtcgtttagtgttagcaatgatcctggttctctataatggtctcacattgtctaatgttgttatatgtgtaaccatagtaagct |
44976828 |
T |
 |
| Q |
200 |
gcgatccgcagttgtggtcacaatat |
225 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
44976827 |
gcgatccgcagttatggtcacaatat |
44976802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University